Стержневые растения примеры: примеры мочковатых и стержневых растений

Содержание

У каких растений стержневая корневая система примеры

Корневая система: виды, растения-представители

Корень — часть растения, с помощью которой оно закрепляется в почвенном субстрате и добывает воду и питательные вещества. Это важнейший орган большинства представителей царства растений. Корни представляют собой своего рода основу для вегетирующей массы и иногда составляет большую ее часть. Корневая система может достигать солидных размеров, причудливо разветвляться и уходить далеко вглубь земли.

Корень выполняет функцию накопления в себе питательных веществ и при неблагоприятных условиях он зачастую выступает своеобразным буфером, позволяющим сохранить жизненные силы растения, именно он дает возможность начать новый виток жизни в том случае, если надземная часть существенно пострадала. Таким образом зимует множество многолетников, зеленая масса которых отмирает при наступлении морозов, но восстанавливается от корня с приходом весны.

Виды корневой системы

Каждое растение в процессе своей жизни и эволюции вынуждено было приспосабливаться к разнообразным условиям окружающей среды, будь то повышенная влажность, особенности грунта, отрицательные температуры, сильные ветра и так далее. Кроме того, почва могла иметь избыток или недостаток питательных веществ, варьировалась глубина их залегания в слоях субстрата. Все это существенным образом повлияло на форму корневой системы.

Несмотря на то что корневых систем существует множество, и даже внутри одного вида можно найти существенные различия в строении, выделяют два основных типа: стержневой и мочковатый. Иногда в такой классификации упоминают еще и корневую систему смешанного типа, но она, как правило, представляет собой вариацию стержневой разновидности с большим количеством дополнительных отростков.

Стержневая

Стержневой тип характерен наличием у растения одного явно выраженного утолщенного корня, который уходит на большую глубину. Основной корень развит гораздо сильнее, чем остальные и его легко выявить среди других корешков, которые меньше по размеру.

Наиболее длинные стержневые корни можно встретить у некоторых растений, растущих в пустыне, например, у верблюжьей колючки. Ее корень может уходить вглубь до отметки 20 метров.

Стержневая корневая система характерна и для множества хорошо известных садовых культур: овощей, деревьев и кустарников. К стержневой корневой системе относят многие овощи с утолщенным корнем, так называемым корнеплодом, часто используемым в кулинарии. К примеру:

С помощью стержневой корневой системы снабжают крону влагой большинство лиственных и плодовых деревьев. Это всем известные дуб, ясень, боярышник, вяз, рябина и многие другие. Сюда же относятся ряд кустарников и садовых цветов, таких как древовидный пион, люпин, подсолнух декоративный и овощной, роза, шиповник. Эти садовые завсегдатаи сравнительно легко переносят жару и засуху.

Интересен тот факт, что под влиянием условий жизни корневая система может менять свое строение. Так, произрастая на влажных почвах, растение склонно развивать больше корней поверхностного типа, так как ему нет необходимости добывать воду с большой глубины. Тогда как развиваясь на сухом участке, растение будет стремиться корнями уйти как можно глубже пытаясь добыть влагу. Ярким примером такой изменчивости служит сосна.

Мочковатая

Мочковатая корневая система имеет форму мочалки, она хорошо разветвлена и представлена большим количеством боковых отростков. Как правило, она формируется у растений, которые происходят из влажных регионов и не приходилось пробираться на большие глубины в поисках влаги и других необходимых веществ. Все сеянцы в начале своего развития формируют основной стержень и только потом обрастают боковыми дополнительными отростками.

Поверхностные корни мочковатого или смешанного типа имеют:

Некоторые из этих деревьев благодаря своей способности вытягивать большое количество воды из поверхностных слоев почвы, используются в качестве осушителей затопленных земель. Но на сухих почвах садовые растения такого типа требуют повышенного внимания, они могут сильно страдать в период затяжного отсутствия дождей.

Понимание того, какое строение имеет подземная часть растения, дает возможность грамотно разместить разные культуры на участке, избегая при этом конкуренции отдельных видов, а также обеспечить каждый экземпляр правильным поливом и уходом. Стоит учитывать, что культуры с различным характером корнеобразования, посаженные рядом зачастую охотно образуют симбиоз и не мешают друг другу развиваться, хотя могут потребовать разного режима полива и освещения.

Видео

О видах корневой системы вы узнаете из этого видео.

Стержневая корневая система: строение и примеры

Находясь под землей и оставаясь абсолютно невидимым, корень образует целые системы, которые напрямую зависят от среды обитания. При необходимости тип может видоизменяться, чтобы обеспечить растение всем необходимым для роста и развития.

Корень и его значение

Корень является подземной частью растения. Он надежно удерживает побег в земле. Длина ствола некоторых деревьев может составлять несколько десятков метров, но даже сильные порывы ветра не страшны.

Основной функцией корня является всасывание и транспортировка воды с растворенными в ней питательными веществами. Это единственный путь поступления необходимого количества влаги в растение.

Типы корней

По особенностям строения выделяют три типа корней.

Главный корень у растения всегда один. У голосеменных и покрытосеменных он развивается из зародышевого корешка семени. От него отходят боковые корни. Они увеличивают площадь поглощающей поверхности, позволяя растению впитать наибольшее количество воды.

Непосредственно от побега отходят придаточные корни. Их очень много, растут они пучком. Все типы корней имеют одинаковые черты внутреннего строения. Этот элемент растения состоит из тканей. Покровная образует корневой чехлик, который защищает образовательные клетки зоны деления от гибели. Зона растяжения также состоит из молодых, постоянно делящихся клеток. Элементы проводящей ткани и механической находятся в зоне всасывания и проведения. Именно они составляют большую часть любого вида корней.

Для обеспечения растения необходимым количеством воды ему недостаточно только одного корня. Поэтому разные виды корней объединяются, образуя системы.

Стержневая и мочковатая корневая система

Мочковатая система представлена придаточными корнями. Они характерны для представителей класса Однодольные — семейств Злаковые, Лилейные и Луковые. Тот, кто пытался вырвать из земли побег пшеницы, знает, что сделать это достаточно сложно. Пучок придаточных корней сильно разрастается, занимает большую площадь, обеспечивая растение необходимым количеством питательных веществ. Луковицы чеснока или лука-порея, являясь видоизменением побега, также имеют развитые придаточные корни, объединенные в мочковатую корневую систему.

Рассмотрим следующий тип. Стержневая корневая система состоит из двух типов корней: главного и боковых. Единственный главный корень является стержнем и объясняет название этого органа растений. Он может проникать глубоко в почву, не только надежно удерживая своего обладателя, но и доставая дефицитную влагу из нижних пластов почвы. Несколько десятков метров для него не преграда.

Стержневая корневая система характерна для большинства покрытосеменных растений, поскольку является универсальной. Главный корень достает воду из глубины, боковые — из верхнего слоя почвы.

Преимущества

Стержневая корневая система характерна для растений, произрастающих в условиях дефицита влаги. Если дождей нет, верхние слои почвы сухие, воду можно достать только глубоко из-под земли. Эту функцию осуществляет главный корень. Стержневая корневая система иногда по длине превышает сам побег. Например, верблюжья колючка высотой около 30 см имеет корень длиной более 20 м.

Боковые корни также имеют важное значение. Они увеличивают поверхность всасывания, иногда занимая значительную площадь.

Какие растения стержневую корневую систему не имеют? Те, которые обитают в условиях избыточного увлажнения. Таким растениям доставать воду из глубины просто не нужно. Однако стержневая корневая система значительно проигрывает мочковатой по общей длине корней.

Видоизменения корня

Стержневая корневая система, строение которой полностью отвечает выполняемым функциям, иногда видоизменяется. Всем известные корнеплоды моркови — это утолщенные главные корни. В них запасается вода и питательные вещества, которые позволяют растениям пережить неблагоприятные условия окружающей среды. Такая видоизмененная стержневая корневая система характерна и для свеклы, редьки, редиски, петрушки.

Особенно часто встречаются корнеплоды у многолетних и двулетних растений. Так, посеяв семена моркови весной, осенью уже можно получить урожай. Но если растение оставить на зиму в земле, то весной оно снова пустит побег и даст семена. В холодную зиму морковь выживает за счет утолщенного главного корня — корнеплода. Он позволяет продержаться на запасах до наступления тепла.

Тип корневой системы растений зависит от условий, в которых оно произрастает, а характерные черты строения обеспечивают процессы жизнедеятельности и увеличивают шансы на выживание в любом климате и при любом доступном количестве влаги и питательных веществ.

Какие растения имеют мочковатую корневую систему

Корень необходим для любого растения. Он обеспечивает надежное механическое удерживание в почве, то есть является якорем. Это важный орган, который впитывает в себя воду и минеральные вещества и снабжает ими растение. От него зависит жизнь и развитие живого организма. Существует несколько типов подземной части представителей царства флоры, среди которых можно выделить мочковатую корневую систему. Каковы ее особенности, какие растения ее обладают?

Что из себя представляет корневая система

Любое растение, независимо от размеров, не может обойтись только одним корнем. Корневая система постоянно растет, формируя сложную систему, состоящую из отростков трех типов: главного, придаточных и боковых. Главным является тот, что берет свое начало от зародышевого корня. Боковые появляются на всех элементах системы. Придаточные развиваются на стебле и на листьях.

Все растения можно разделить на два класса – имеющие стержневую или мочковатую корневую систему. В стержневой главный корень значительно отличается от других. Он длинней и толще остальных, которые в разы уступают ему в размерах. А в мочковатой все корни выглядят практически одинаково. Вся система сформирована за счет хорошо развитых боковых и придаточных отростков, главный же ничем от них не отличается. Главный корень появляется первым, но по мере роста растения он перестает развиваться или отмирает.

Основная задача наиболее старых корней — надежно удерживать растение в земле. Они также выступают в роли проводника, снабжающего поверхностную часть растения жизненно необходимыми элементами. Обязанностью более молодых и тонких корешков является вбирание в себя воды и полезных веществ из грунта.

Растения с мочковатой корневой системой

Мочковатую корневую систему имеют все растения, относящиеся к однодольным. К ним относятся злаковые культуры: пшеница, ячмень, кукуруза, рожь. Аналогичной системой обладают лук и лилейные растения, их корни растут из луковиц.

Несмотря на то что мочковатая корневая система характерна для однодольных растений, есть некоторые представители двудольных с аналогичным строением подземной части. Например, подорожник. Хотя есть мнения, что он скорее обладает смешанным типом, так как в молодом возрасте у него есть наблюдается главный корень. Он со временем отмирает, а боковые начинают развиваться все больше. Аналогичной системой обладает подсолнух и еще некоторые растения.

Особенность корневой системы у деревьев

Мочковатая корневая система характерна для деревьев, произрастающих на тяжёлых типах грунта — там, где земля содержит много воды близко к поверхности. Кроме того, часто встречается у древесных растений, произрастающих на склонах. Подобные условия оказывают влияние на формирование корней. Наиболее важным становится обеспечение устойчивости, чем добыча питания, которое в достатке можно найти в поверхностном слое почвы. Мочковатую корневую систему имеют белая акация, ель, осина, ива, ольха, тополь. Если корневая система развита недостаточно хорошо или часть ее по каким-то причинам повреждена, в таком случае повышается вероятность падения дерева при сильных порывах ветра. Оно будет просто вырвано из земли с частью корней.

Деревья со смешанным типом корневой системы

Существует большое количество деревьев, которые обладают смешанным типом подземной части.

Развитую мочковатую корневую систему имеют растения: яблоня, береза, рябина, клён, бук. Но при этом они имеют неплохо развитый центральный корень. Корневая система этих древесных растений адаптируется к условиям грунта, где они произрастают. Поэтому экземпляры, растущие в разных условиях, могут не иметь идентичной корневой системы. У одних может быть больше развит стержневой корень. А у других скорее мочковатая корневая система за счет лучшего развития боковых корней.

Глубина залегания

Большая часть однолетних растений не может похвастаться большой глубиной залегания корней. Это им не нужно, все минералы и влага, необходимые для роста, находятся на поверхности. Поэтому они редко проникают в почву глубже 30 см.

Мочковатая корневая система злаковых растений имеет более глубокое залегание. Часть корней достигает глубины 2 метра. У клевера очень глубоко уходят корни вглубь, достигая отметки в 3 метра. У деревьев корни могут достигать глубины от 10 метров и больше.

А у верблюжьей колючки, которая растёт в пустыне, где воду на поверхности практически не найти, корни прорастают на глубину, превышающую 15 м.

Диаметр корневой системы

Корневая система развивается не только по направлению вниз, но и горизонтально. Ее размер зависит от места произрастания, размера самого растения. Так как корни развиваются на протяжении всего жизненного цикла организма, то у деревьев за несколько десятков лет она развивается намного сильнее, чем у однолетних растений. Поэтому, чтобы лучше фиксировать дерево в земле, диаметр корневой системы может быть больше диаметра кроны в 3-5 раз. В некоторых случаях может быть меньше или больше.

Так как обычно двудольные растения обладают стержневой корневой системой, а однодольные – мочковатой, то, зная признаки каждого типа, можно понять, какие растения имеют мочковатую корневую систему, а какие — стержневую. Но в обоих случаях встречаются исключения. Кроме того, существуют растения с измененными корнями, например, клубни у картофеля.

Стержневые и мочковатые корневые системы.

Представьте себе, травы, кустарники и деревья без корней. Огромные дубы и маленькие травянистые растения, лишенные корня, окажутся беспомощно Лежащими на земле. Корнями растения укрепляются в почве. С помощью корней растения прочно удерживаются на одном месте в течение всей своей жизни.

Вырастая из маленького корешка зародыша семени, корень взрослых растений, особенно деревьев и кустарников, глубоко проникает в почву, достигает больших размеров и с силой удерживает тяжелейшие ствол и ветви с листьями. Чтобы представить, с какой силой корни удерживают деревья, раскройте во время сильного ветра зонт и попробуйте удержать его в руках. Ветер будет яростно рвать зонт из рук, удержать его очень трудно.

Тяжелый ствол дерева со всеми ветвями и листьями можно сравнить с гигантским зонтом. Ураганный ветер в состоянии подхватить такой «зонт» и вырвать дерево из земли. Однако это случается не так уж часто. Корни, удерживающие дерево в почве, очень прочны. Конечно, не все корни так мощны, как корни деревьев. У однолетних травянистых растений корни чаще небольшие, неглубоко проникшие в почву. Познакомимся с корнями различных растений. Почти всюду растет невысокая травка с тоненькой метелкой невзрачных цветков. Это мятлик. Найдите мятлик, выкопайте его с корнем. Выкопайте также одуванчик, стараясь возможно меньше повредить его корень.

Теперь рассмотрите корни выкопанных растений.

Одуванчик имеет хорошо развитый главный корень . Он развивается из зародышевого корня семени. От главного корня отходят небольшие боковые корни.

У мятлика много корней, почти одинаковых по длине и толщине, и они растут пучком. Эти корни отрастают от стебля и называются придаточными. Главный корень среди придаточных корней мятлика не заметен.

Если рассматривать корни самых разнообразных растений, то можно обнаружить, что одни из них похожи на корни одуванчика, а другие — на корни мятлика.

Все вместе взятые корни растения составляют его корневую систему.

Рис. 29. Корневая система мятлика (1) и одуванчика (2).

Рис. 30. Схема корневой системы растения: 1 — главный корень; 2 — придаточные; 3 — боковые.

Рис. 31. Виды корневых систем: 1—4 — стержневая; 5 — мочковатая.

Главные корни развиваются из корешка зародыша семени и обычно бывают похожи на стержни. Поэтому у растений с хорошо развитым главным корнем корневую систему называют стержневой. Если же главный корень незаметен среди всех других, растущих пучком, то корневую систему называют мочковатой.

Таким образом, как бы разнообразны ни были цветковые растения, корневая система у одних будет мочковатой, у других— стержневой.

Подмечено, что большинство двудольных растений имеет стержневые корневые системы, развивающиеся из зародышевого корешка семени. Хорошо заметный главный корень имеют, например, щавель, фасоль, подсолнечник, морковь, все деревья, кустарники и многие другие растения.

Мочковатой корневой системой чаще обладают однодольные растения. Мочковатую корневую систему имеют все наши хлебные злаки, лук, чеснок и сравнительно немногие другие растения.

Интересно проследить, как развивается мочковатая корневая система. Главный корень, развивающийся из корешка зародыша семени, вскоре перестает расти. Он становится незаметным среди множества придаточных корней, отрастающих от подземной части стебля. Придаточные корни почти одинаковы по толщине, растут пучком и скрывают переставший расти главный корень.

Итак, корни могут образовываться по-разному. Во-первых, корни развиваются из корешка зародыша семени. Это главные корни. Во-вторых, корни отрастают от стебля. Это придаточные корни. В-третьих, корни отрастают и от главного и от придаточных корней. Это боковые корни. Интересно отметить, что придаточные корни развиваются не только от подземной части стебля, но и от наземных побегов.

Легко наблюдать развитие придаточных корней, если поставить в воду ветки тополя, ивы или черной смородины. Придаточные корни развиваются также у картофеля, капусты и некоторых других растений, если окучить почвой нижнюю часть их стеблей, растущих над землей.

Если вы нашли ошибку, пожалуйста, выделите фрагмент текста и нажмите Ctrl+Enter.

Многолетники со стержневой корневой системой: размножаем правильно

Многолетники со стержневой корневой системой плохо приживаются после деления и пересадки. И как же быть?

У каких растений стержневая корневая система?

У таких растений корень, который развивается как продолжение стебля, называется главным, от него отходят боковые. Верх корня вместе с нижней утолщенной частью стебля образует каудекс – одноглавый, если стебель один, или многоглавый, если их несколько. На каудексе закладываются почки возобновления. Стержневой корневой системой обладают всем известные аквилегии, армерия приморская, гипсофила метельчатая, коровяки, люпин, маки, молочай, многие зонтичные (в том числе синеголовник), прострел, ясенец. Стержневой корень может быть толстым (веретеновидным), как у аканта, колокольчиков широколистного, крапиволистного, молочноцветкового, кодонопсиса, лунника оживающего, мальвы, баптизии.

Стержнекорневые растения не любят пересадок – лучше сажать их сразу на постоянное место. В цветнике они стабильно занимают отведенную им нишу, чем и ценны. Если пересадка все же требуется, можно весной подрубить лопатой главный корень на глубине, тогда к осени корневая система станет более ветвистой и компактной, и пересадка пройдет успешнее.

Как размножаются растения со стержневой корневой системой?

Стержнекорневые растения чаще размножают семенами. Сеянцы и молодые растения могут выпирать весной на глинистых почвах, и после стаивания снега их нужно заглублять. Однако, если растение не завязывает семена или оно сортовое, можно использовать корневые и зеленые черенки или деление корней.

Что такое корневые отпрыски?

Некоторые растения со стержневыми корнями способны произвольно образовывать почки на неглубоко расположенных горизонтально растущих корнях. Как пример можно привести ветреницы (лесную, японскую и ее гибриды), колокольчики (рапунцель, крапчатый и его гибриды, Такесима), термопсис, хрен. Они образуют постоянно нарастающую куртину над зоной залегания корней и чаще всего агрессивны, как и многие корневищные растения, уход и размножение такие же. Осенние ветреницы, которые не любят пересадку, делят весной, просекая ножом или лопатой землю между стеблями. Через год весной отсаживают деленки.

Размножение растений зелеными черенками

При зеленом черенковании (с использованием зеленых стеблей и листьев) полезно применять укоренители, например «Корневин». Укоренять такие черенки лучше в парничке, устроенном в притененном, нежарком месте. При небольших количествах материала можно накрывать посадки пластиковой бутылкой. Посадки регулярно опрыскивают и проветривают. После укоренения (от 1 до 1,5 месяца) парник открывают. На зиму растения укрывают лапником или листьями. Рассаживают весной.

Стеблевыми черенками можно размножить аквилегию, качим, люпин, мак восточный, пион. Берут их во время активного роста, то есть у одних (люпин, мак) в течение всего вегетационного периода, у других (аквилегия, пион) – до цветения. Обычно используют верхнюю часть побега, которую нарезают на кусочки из 2–3 междоузлий. В некоторых случаях отрывают (не срезают) боковые розетки или мелкие побеги с пяткой – кусочком каудекса. Черенки сажают с наклоном в сделанные палочкой отверстия глубиной 1–1,5 см.

Черенкуют листьями инкарвиллею (июль), люпин (июль), ясенец (июнь). Выбирают хорошо сформированные листья и сдергивают их со стебля, что называется «с пяткой». Сажают с наклоном на глубину 1–1,5 см. Сроки укоренения – от 1 месяца у инкарвиллеи до 2,5 месяца у ясенца.

Мастер-класс по размножению растений корневыми черенками

Черенкуют растения, способные образовывать на корнях почки: акант, сортовые коровяки, мак восточный и его сорта, синеголовник, кермек, прострел. Более успешный результат можно получить, высаживая черенки в горшки с рыхлой, легкой, как для посевов, почвой. Нужно поддерживать постоянную влажность почвы, но без застоя воды. Стимуляторы не применяют.

Сроки черенкования индивидуальны. Например, мак восточный черенкуют после отмирания листвы до морозов. Черенки нарезают длиной до 5 см. Укоренение происходит через 1–2 месяца. Коровяки черенкуют до начала июня.

1 шаг. Маточный куст мака восточного выкопайте и отрежьте ножом один-два крупных корня. Рассеките их на кусочки 5–8 см длиной, делая нижние срезы косыми.

2 шаг. Корневые черенки воткните строго вертикально вровень с почвой верхушкой вверх, присыпьте слоем грунта или крупного песка около 1,5 см и полейте.

3 шаг. Горшки с черенками накройте пленкой или стеклом и поставьте в тень. После появления листьев пленку снимите.

Мастер-класс по размножению растений делением корней

Делят толстые корни со сформированным каудексом и почками возобновления (аквилегия, зонтичные, люпин, молочай, ясенец). Делают это перед началом активного роста, весной. Правда, такой способ используют редко – он довольно ненадежный.

1 шаг. Маточник выкопайте, главный корень разрежьте продольно, так, чтобы на каждой половине остался кусочек стебля с двумя-тремя почками.

2 шаг. Срез подсушите и присыпьте золой.

3 шаг. Высадите деленку в горшок или на постоянное место.

У каких растений стержневая корневая система примеры. Растение с поверхностной корневой системой Видоизмененные побеги под землей

Береза повислая . Широко распространена в европейской части нашей страны от южных районов до границ лесотундры.

Обычно она участвует в качестве примеси к широколиственным или хвойным породам в самом разном сочетании в различных типах лесорастительных условий. Несмотря на ее широкое распространение, морфология корневой системы березы до последнего времени малоизучена.

В условиях свежей су дубравы на средне-дернованных среднеподзолистых почвах в сосново-березовых насаждениях I класса бонитета, полнотой 0,8 корни березы имеют 10-15 хорошо развитых горизонтальных корней первого порядка, образующих в верхних горизонтах почвы густую сеть скелетных, полускелетных и всасывающих корней. В 27-летнем возрасте длина горизонтальных корней первого порядка достигает 8,05 м, диаметр 13,6 см. Стержневые корни развиты слабо, проникают в глубь почвы на 95-115 см. У большинства деревьев наблюдается большое количество хорошо развитых вертикальных ответвлений от горизонтальных корней, некоторые из них проникают в почву на большую глубину по сравнению со стержневыми корнями. Однако у отдельных деревьев отмечается полное отсутствие вертикальных ответвлений. Протяженность скелетных корней горизонтальной ориентации и их ответвлений зависит от группы роста дерева.

По сравнению с другими породами береза имеет самый высокий коэффициент ветвистости — 17,2 (сосна 3,0, дуб 1,5, ель 5,6, клен 1,8). Площадь проекции корневых систем составляет 33,1-46 м 2 , объем почвы, занимаемый корнями, 11,0-43,7 м 3 в зависимости от группы роста дерева.

Интенсивность корненаселенности занимаемого объема почвы у разных деревьев различна — от 19,1 до 111,1 м/м 3 , т. е. по сравнению с сосной в 1,8-2,6 раза больше. Среднегодовой прирост по объему почвы, занимаемому корнями, достигает 4,1 м 3 , по общей длине корней 15,4 м 3 , по поверхности всасывающего пространства корней 9,1 дм 3 .

Граб обыкновенный

. Обычно в естественных условиях граб не образует чистых древостоев, однако значение его как сопутствующей породы велико. Широко распространен в широколиственных лесах юго-запада европейской части СССР. Характеризуется как порода, имеющая мощную поверхностную корневую систему.

В корневой системе граба в 15-летних дубово-грабовых культурах в условиях Винницкой области на серых лесных почвах (тип лесорастительных условий — свежая дубрава) преобладают корни горизонтальной ориентации.

Однако в этом же возрасте часто обнаруживаются хорошо развитые стержневые корни, имеющие высокую степень разветвленности и проникающие на глубину до 1,9 м. Горизонтальные корни первого порядка достигают длины 5,9 м. Степень разветвленности высокая, имеются скелетные корни седьмого-восьмого порядков ветвления. В общей протяженности корней преобладают корни второго порядка ветвления, в общей массе — первого, а по количеству ответвлений — третьего порядка ветвления.

Бук лесной

. На территории СССР бук естественно произрастает в Калининградской области, в Карпатах и Предкарпатье, Кодрах Молдавии и в Крыму. Строение корневой системы бука лесного, так же как и пихты белой, изучено недостаточно.

Так же как и у ели, корневая система бука в 11-22-летних елово-буково-пихтовых культурах в условиях Карпат на высоте 750-1000 м над ур. м. имеет выраженное поверхностное строение.. Стержневой корень в 11-22-летнем возрасте деревьев обычно отсутствует. Он трансформируется в короткое утолщение, являющееся продолжением ствола дерева.

Относительное участие горизонтальных корней в общей длине скелетных составляет 99,2-99,96 %, в общей массе корневой системы 70,1-73,2 %. У отдельных деревьев может быть по 3-4 вертикальных ответвления, некоторые из которых имеют интенсивное ветвление и проникают в глубь почвы по расщелинам до 160 см. Однако на более глубоких щебенистых почвах встречаются единичные деревья, стержневой корень которых в 18-летнем возрасте через расщелины в скальных породах проникает до глубины 241 см.

Корни бука первого порядка отличаются сильной сбежистостью у основания. Затем на расстоянии 0,1 длины их диаметры уменьшаются относительно длины более умеренно, и корни приобретают более выраженную шнуровидную форму. Характер сбежистости корня выражают следующие коэффициенты формы по относительным длинам: 0,1-62,3; 0,2-50,4; 0,5-27,8; 0,7-16,5; 0,9-7,9 %. Коэффициенты формы и коэффициент объема корня (0,1800) свидетельствуют об относительно небольшой сбежистости скелетных корней бука.

Площадь проекции корневой системы у деревьев лучшего роста в 22-летнем возрасте составляет 60,6 м 2 (у средних деревьев 21,2, у отстающих в росте 10,5 м 2). Объем почвенного пространства, занимаемого корневыми системами в этом возрасте, у деревьев лучшего роста равен 36,4 м 3 , средних 12,7, отстающих в росте 3,2 м 3 . Коэффициент компактности корневой системы соответственно составляет 14,3; 16,6 и 20,6 м/м. Эти показатели несколько выше, чем у ели европейской.

Дуб черешчатый . Произрастает в пределах своего естественного ареала в средней и южной зонах европейской части СССР, в Крыму и на Кавказе. В пределах такого широкого ареала дуб встречается в различных типах лесорастительных условий и типах леса. Являясь породой, требовательной к плодородию почвы, дуб в естественных условиях образует смешанные насаждения на почвах, представляющих относительно широкий диапазон как по плодородию, так и по характеру увлажнения. Однако в определенных эдафических условиях он может иметь III-IV классы бонитета, образуя второй ярус в смешанных древостоях на сухих, бедных песчаных почвах. В более благоприятных условиях он выходит в первый ярус, достигая II или I класса бонитета, а на богатых, хорошо увлажненных почвах — I и Iа классов бонитета.

Лучшие условия для роста дуба черешчатого — свежие и влажные серые лесные суглинки, деградированные черноземы, мощные бурые горно-лесные почвы. Под влиянием почвенных условий формируются особенности строения корневой системы дуба. Обладая способностью образовывать с самых первых лет мощный стержневой корень, дуб на почвах с избыточным увлажнением формирует поверхностную корневую систему, при относительно недостаточном увлажнении дает хорошо развитые вертикальные ответвления от горизонтальных корней, на почвах с наличием уплотненных горизонтов типа ортштейна образует второй ярус корней над его поверхностью.

В корневой системе дуба на черноземах обыкновенных малогумусных с признаками южного чернозема в дубово-ясеневых культурах преобладают корни вертикальной ориентации. Вертикальные ответвления начинают появляться в 10-летнем возрасте, но уже в 18 лет они составляют около 20 % общей длины горизонтальных корней. Горизонтальные корни слабо разветвлены. Наиболее высокое относительное участие составляют скелетные корни первого порядка. Разветвление стержневого корня более интенсивное по сравнению с горизонтальными корнями.

Глубина проникновения стержневых корней дуба достигает в 10-летнем возрасте 4,05, в 18-летнем 4,86. Развитие вертикальных ответвлений от горизонтальный корней интенсивное. Некоторые из них по диаметру и длине превышают стержневой корень, достигая глубины 250-280 см. Основное количество корней располагается в верхних горизонтах почвы. У деревьев лучшего роста до 83,8 % горизонтальных скелетных корней размещается на глубине до 20 см, 95 % — в 0-40-сантиметровом слое почвы.

На черноземах деградированных формируется более поверхностная корневая система дуба. Относительное участие корней горизонтальной ориентации на 13-20 % больше с соответственным уменьшением количества вертикальных ответвлений и стержневых корней. В то же время отмечается значительно большая разветвленность горизонтальных и стержневых корней, несмотря на то что наибольшее относительное участие сохраняется за корнями первого порядка ветвления. Резко сокращается глубина проникновения стержневого корня в почву. Она составляет у деревьев лучшего роста в 9-летнем возрасте 167 см, 16-летнем 183, 18-летнем 195 см. Это более чем в 2 раза меньше по сравнению с глубиной проникновения корней дуба черешчатого на черноземах обыкновенных малогумусных в южной степи.

На серых лесных почвах в свежих типах лесорастительных условий в структуре корневой системы дуба относительное участие вертикальных ответвлений в 2-2,5 раза больше, чем на деградированных почвах, и почти в 3 раза больше, чем на черноземах обыкновенных. Интенсивность развития горизонтальных корней и стержневого корня здесь значительно выше, чем на деградированных и обыкновенных черноземах. Общая протяженность скелетных корней в этих условиях уже в 10-летнем возрасте в несколько раз больше, чем у деревьев 16-19-летнего возраста в ранее рассмотренных условиях. Глубина проникновения стержневого корня на серых лесных почвах достигает в 10-летнем возрасте 190 см, а в 25-летнем 555 см, что намного больше по сравнению с другими почвенными разностями. Вертикальные ответвления также интенсивно развиты и уже в 10-летнем возрасте достигают глубины 215 см. Следовательно, свежие лесные суглинистые почвы наиболее благоприятны для роста дуба черешчатого.

Некоторые изменения в строении корневых систем по сравнению с серыми лесными почвами Правобережья Украины и черноземами наблюдаются в условиях дерново-подзолистых и серых лесных почв западной части лесостепи. Общая интенсивность развития корневых систем здесь меньше, чем на черноземах и серых лесных почвах Правобережья. Намного слабее развивается стержневой корень, росту которого в глубь почвы здесь препятствуют уплотненные горизонты почвы ортштейнового характера с признаками оглеения. Глубина проникновения стержневого корня достигает на дерново-подзолистых почвах в 14-летнем возрасте 160 см, на серых лесных 220 см.

Корневые системы деревьев старшего возраста полностью оформляются на последнем этапе своего развития. Горизонтальные корни дуба в 90-летнем возрасте (насаждение I класса бонитета, почва средне-дерново-слабоподзолистая легкосупесчаная на флювиогляциальных отложениях) представлены мощными корнями первого порядка, расположенными у поверхности почвы на глубине до 30 см. От стержневого корня на глубине 32-60 см отходят 11 корней горизонтальной ориентации.

Интенсивность ветвления корней довольно слабая, наибольшее количество ответвлений-тратьего порядка. Горизонтальные корни образуют сеть шнуровидных корней, расположенных у самой поверхности почвы. Длина наиболее развитого корня первого порядка составляет 22,4 м. Общая длина скелетных поверхностных горизонтальных корней с ответвлениями до пятого порядка составляет 1995 м, глубинных 207,9 м. Поверхностные горизонтальные корни имеют вертикальные ответвления длиной до 113 м, что составляют около 5 % общей протяженности этих корней. Глубинные корни горизонтальной ориентации отличаются слабым развитием. Наибольшее относительное участие у этой категории корней составляют корни второго порядка.

Особенностью глубинных корней горизонтальной ориентации является их способность образовывать вертикальные ответвления, которые могут быть направлены не только вглубь, но и вверх — к поверхности почвы. Поверхностные горизонтальные корни обладают хорошо выраженной досковидностью, у основания корня их вертикальный диаметр может превышать горизонтальный в 5-8,5 раза. Различие в размерах вертикального и горизонтального диаметров исчезает на расстоянии 60-140 см от основания корня в зависимости от его крупности. Глубинные горизонтальные корни досковидностью не обладают.

Стержневой корень 90-летнего дуба имеет множество ветвлений большого диаметра, сильно переплетенных между собой и почти полностью сросшихся в верхней части. Со стержневым корнем и его ответвлениями переплетаются и срастаются якорные корни, образовавшиеся в непосредственной близости у ствола дерева. Глубина проникновения основного корня составляет 178 см, якорных — до 250 см. Стержневая часть корневой системы дуба черешчатого представляет единое, монолитное сплетение стержневого корня и ближайших якорных корней, сросшихся между собой.

Протяженность поддающихся учету элементов этой сросшейся системы равна 17,8 м. Суммарно протяженность стержневой части корневой системы и вертикальных ответвлений от стержневых корней составляет примерно 130 м, или 5 % общей длины скелетных корней.

У дуба, как и у других древесных пород, в корневой системе в основном участвуют корни горизонтальной ориентации, наиболее интенсивно осваивающие верхние горизонты почвы в пределах 0-60 см. Вместе с тем дуб обладает способностью в оптимальных для него почвенно-гидрологических условиях образовывать глубоко идущий и сильно развитый стержневой корень. Способность же его образовывать вертикальные ответвления от горизонтальных корней несколько меньшая, чем у многих древесных пород (сосна, орех, каштан, липа, ель). Интенсивность разветвления корней дуба слабая, причем значительного варьирования этого признака под влиянием почвенных условий не установлено.

Средний коэффициент ветвистости корней дуба выражается показателем 1,46, что ниже его значения, полученного для других древесных пород. Интенсивность сбежистости скелетных корней дуба определяется коэффициентами формы корня на относительных длинах: 0,1 — 72,4±0,55; 0,2 — 56,2±0,63; 0,5 — 29,8±0,54; 0,7 — 16,7±0,4; 0,9-7,4+0,20. Коэффициент объема горизонтальных скелетных корней дуба 0,1851, что свидетельствует о большой шнуровидности его корней по сравнению с другими породами.

Площади проекции корневых систем дуба могут достигать к 19-летнему возрасту 50 м 2 , к 25-летнему более 60 м 2 . Превышение площади проекций корневых систем над площадью проекций крон составляет от 5,4 до 8,4. Большая глубина проникновения корней в почву обеспечивает дубу быстрое освоение значительных объемов почвенного пространства, что делает исключительным показатель компактности его корневой системы, находящийся в пределах 1,9-10,8.

Липа крупнолистная . Широко распространена в лесах европейской части СССР. Произрастает на различных почвах, предпочитая более богатые, свежие лесорастительные условия. Выступает в естественных насаждениях и используется в культурах в качестве сопутствующей породы с дубом, сосной, лиственницей, как правило, образует второй ярус, а в менее благоприятных условиях — третий.

Корневая система хорошо развита. В ее структуре (в 12-летних культурах, на серых лесных суглинистых почвах) корни горизонтальной ориентации составляют 78,6-93,6 %. У дерева лучшего роста стержневой корень отсутствует, у среднего и отстающего в росте он занимает 3,1 и 9,9 % общей длины скелетных корней. Разветвленность скелетных корней ограничивается образованием корней третьего порядка. Вертикальные ответвления от горизонтальных корней составляют 3,6-11,2 %.

Структура и строение корневой системы липы свидетельствуют о ее поверхностном размещении. Глубина проникновения корней составляет у дерева лучшего роста 40 см за счет углубления горизонтальных корней. В этом 40-сантиметровом слое почвы размещены все 100 % корней дерева лучшего роста. Стержневые корни деревьев среднего роста и отстающих в росте достигают глубины 80 и 70 см. Среднегодовой прирост наиболее крупного горизонтального корня составляет 21,7, среднего 14,3 см. Эти показатели значительно ниже, чем у других древесных пород в этом насаждении (у клена явора 40,8 и 15,7, березы повислой 35,4 и 27,1, сосны обыкновенной 0,43 и 16,3, дуба черешчатого 28,9 и 17,5 см).

Интенсивность разветвленности корней липы средняя. Она характеризуется коэффициентом ветвистости 2,1. Это несколько больше, чем у клена явора (1,8) и дуба (1,5), но значительно меньше, чем у других совместно произрастающих пород (у сосны 2,5, березы 17,2).

Сбежистость корней липы определяется коэффициентами формы на относительных длинах: 0,1 — 0,657±0,016; 0,2 — 0,472±0,017; 0,5 — 0,330±0,018; 0,7 — 0,220±0,012; 0,9 — 0,104±0,04. Коэффициент объема корней 0,1701, что соответствует среднему значению среди других древесных пород.

Площадь проекции корневой системы липы меньше, чем у других пород: у дерева лучшего роста 9,3 м 2 , среднего 10,0, отстающего в росте 1,3 м 2 . Объем почвенного пространства, занимаемого корневой системой, соответственно равен 2,2; 2,7; 0,3 м 3 . Коэффициент компактности корневой системы очень высок. У дерева лучшего роста он составляет 37,7, у среднего 19,1.

Клен остролистный . Как и дуб, клен широко распространен в лесах европейской части СССР. Однако биометрическая характеристика корневой системы клена малоизучена. При совместном произрастании в культурах дуба клен остролистный имеет хорошо развитую корневую систему, состоящую из стержневого корня, проникающего в глубь почвы на 3 м, и мощных корней горизонтальной ориентации. Интенсивность корненаселенности верхних горизонтов почвы у клена почти не уступает таковой у дуба черешчатого.

Клен явор . Произрастает в Карпатах в качестве примеси в еловых, буковых и пихтовых лесах. Вместе с тем он широко распространен в равнинных лесах Прикарпатья. Древесина этой породы имеет большую хозяйственную ценность.

Клен явор отличается хорошо развитыми стержневым и горизонтальным корнями. Горизонтальные корни имеют ответвления третьего и четвертого порядков. Корни вертикальной ориентации представлены стержневым корнем и его ответвлениями второго и третьего порядков. Основная масса корней на бурых горно-лесных почвах расположена в 0-30-сантиметровом слое, однако отдельные стержневые корни проникают на глубину более 1 м. У явора, как и у других пород, в общей длине корней преобладают корни горизонтальной ориентации (81,2-99,2 %), участие же стержневого корня в общей массе корней у явора значительно больше. В общей протяженности корней явора преобладают корни второго-третьего порядков.

Протяженность скелетных корней у явора меньше, чем у ели, пихты и бука, но в отличие от них у этой породы интенсивнее развиты стержневые корни и вертикальные ответвления от горизонтальных корней.

Различие в почвенных условиях отражается на структуре и строении корневых систем. На глубоких серых лесных почвах относительное участие стержневого корня в общей длине существенно больше, чем на бурых горно-лесных почвах средней мощности, а длина стержневого корня с ответвлениями на серых лесных почвах в 2,5-8 раз больше. В этих условиях более интенсивно развиты и вертикальные ответвления от горизонтальных корней. Максимальная глубина проникновения стержневого корня на бурых горно-лесных почвах составляет 120 см, на серых лесных в 12-летнем возрасте у деревьев среднего роста — 123 см, лучших — 510 см.

Сбежистость горизонтальных корней клена явора характеризуется следующими коэффициентами формы по относительным длинам корня: 0,1 — 67,3±0,01; 0,2 — 46,0+0,01; 0,5 — 24,4±0,07; 0,7 — 16,2+0,01; 0,9 — 9,2±0,003. Коэффициент объема для горизонтальных корней первого порядка 0,1444. По интенсивности сбежистости корни явора занимают среднее положение среди представленных в данном учебнике древесных пород. Интенсивность разветвленности корней клена явора очень низкая (средний коэффициент ветвистости составляет 1,8).

Максимальная величина среднегодового прироста по длине горизонтального корня первого порядка составляет 21,7 см, средний прирост 14,8 см, среднегодовой прирост стержневого корня 6,7 см. Отношение интенсивности роста стержневого и среднего горизонтального корней составляет на серых лесных почвах 0,47.

Площадь проекций корневой системы к 18-летнему возрасту на бурых горно-лесных почвах достигает 20,4 м 2 , на серых лесных почвах в 12-летнем возрасте 11,2 м 2 , что соответствует площади проекции корней деревьев 14-летнего возраста (11,5 м 2) на бурых почвах Карпат.

Корневая система клена явора на серых лесных глубоких почвах отличается невысокой компактностью. Благодаря стержневому корню, который интенсивно проникает вглубь, корневая система относительно быстро занимает обширный объем почвенного пространства. В 12-летнем возрасте в этих условиях объем почвы, занимаемый корневыми системами, составляет для дерева лучшего роста 19,3 м 3 , среднего 18,9 и отстающего 1,1 м 3 ; коэффициент компактности корневых систем соответственно 2,6; 2,9 и 2,9 м/м 3 . Однако этот показатель возрастает в 10 и более раз на среднемощных бурых горно-лесных почвах, где у деревьев лучшего роста в 8-летнем возрасте он составляет 36,3, в 12-летнем 26,3 и в 17-летнем 23,2 м/м 3 .

Орех грецкий . В естественных лесах произрастает в горных районах Киргизии. Широко культивируется в Средней Азии, на Кавказе, Украине, в Молдавии и на юге Белоруссии. Предпочитает свежие и влажные достаточно богатые почвы (черноземы и серые лесные почвы). Уже к 6-летнему возрасту на серых лесных почвах у ореха формируются не только хорошо развитые стержневой и горизонтальные корни, но и значительное количество вертикальных ответвлений. Глубина проникновения стержневых корней в этом возрасте составляет в зависимости от группы роста дерева 273, 241 и 194 см. Ответвления от стержневого корня расположены равномерно по всей его длине. Суммарная протяженность вертикальных ответвлений от корней горизонтальной ориентации составляет 6,9-12,3 % общей длины скелетных корней. У каждого дерева насчитывается 8-10 вертикальных ответвлений. Глубина проникновения их также различна в зависимости от группы роста дерева. Так, у деревьев, отстающих в росте, она составляет 49-67 см, деревьев среднего роста 82-124, лучшего 120-241 см. Среднегодовой прирост по длине корней горизонтальной ориентации составляет 61-73 см, по диаметру 3,4-9,5 мм.

Разветвленность корней довольно интенсивная: 420-820 скелетных ответвлений. Наивысший порядок ветвления в этом возрасте — четвертый, однако корней этого порядка очень мало (0,3-0,9 %). Основное относительное участие в общей протяженности скелетных корней принимают корни второго порядка ветвления (39,1-55,8 %).

В общей протяженности скелетных корней ореха грецкого существенное относительное участие принимают вертикальные ответвления от горизонтальных корней. Компактность корневых систем незначительная.

Орех грецкий отличается высокий интенсивностью прироста корней по диаметру, достигающего у корней горизонтальной ориентации 0,95, а у стержневых корней 1,05 см. Площадь горизонтальной проекции корней составляет соответственно по группам роста деревьев 38, 26 и 23 м 2 , что превышает площадь проекций крон соответственно в 2,9; 3,9 и 5,5 раза.

Сбежистость корней характеризуется следующими коэффициентами формы корней на соответствующих относительных длинах: 0,1 — 56,5; 0,2 — 35,1; 0,5 — 26,1; 0,7 — 18,7; 0,9 — 11,4. Коэффициент объема корней 0,1207.

Лещина обыкновенная . Широко распространена в европейской части СССР как подлесочная порода. В пределах своего естественного ареала она встречается в свежих и влажных гигротопах на черноземных, буроземных, серых лесных, дерново-подзолистых почвах, обладающих высоким плодородием.

Корневая система лещины в условиях запада Украины на дерновослабоподзолистых легкосуглинистых почвах в свежей грабовой судубраве в 90-летних сосняках Iа класса бонитета такова: стержневые корни отсутствуют, горизонтальные имеют высокую ветвистость. Общая протяженность скелетных корней одного куста достигает 256 м, из которых корни первого порядка ветвления составляют 8,7, второго 40,8 и третьего 50,5 %. Общее число ответвлений у наиболее развитых кустов 850, в том числе первого порядка 1,1, второго 21,9, третьего 77,1 %. Коэффициент ветвистости корней высокий — 7,8. Сбежистость корней первого порядка характеризуется коэффициентами формы на относительных длинах: 0,1- 0,54; 0,2 — 0,38; 0,5 — 0,25; 0,7 — 0,174 и 0,9 — 0,14. Коэффициент объема скелетных корней первого порядка 0,1224.

Основная масса корней лещины расположена на глубине 0-30 см, однако отдельные корни проникают вглубь до 60 см. Корни лещины, расходясь далеко в стороны от куста, осваивают значительную площадь питания, достигающую 15 м 2 . Несмотря на это, коэффициент компактности корневой системы у нее составляет 28,3 %. Таким образом, корневая система лещины довольно интенсивно населяет верхний горизонт почвы в насаждениях.

Каштан съедобный (посевной) . Каштан съедобный (посевной), европейский, или благородный, естественно произрастает на Кавказе, а также широко распространен в Карпатах, образуя в культурах высокопроизводительные ценные древостой. Каштан образует глубокую корневую систему за счет крупных корней, идущих косовертикально в глубь почвы. Стержневой корень отсутствует. Корневые системы деревьев 10-летнего возраста в культурах каштана с участием дуба черешчатого на карпатских бурых горно-лесных почвах состоят из стержневого корня, горизонтальных корней и вертикальных ответвлений от горизонтальных корней. Часть горизонтальных корней уходят в почву под хорошо выраженным углом в косовертикальном направлении. Скелетных корней первого порядка у деревьев лучшего роста немного, а у деревьев, отстающих в росте, их значительно больше. В то же время у деревьев, отстающих в росте, отсутствуют ответвления второго порядка и вертикальные ответвления от горизонтальных корней, а стержневые корни развиты значительно слабее. Это свидетельствует о том, что более слабые деревья осваивают жизненное почвенное пространство более молодыми горизонтальными корнями первого порядка.

В структуре корневой системы каштана посевного основное относительное участие принимают корни горизонтальной ориентации. Однако обращает на себя внимание очень высокое относительное участие корней вертикальной ориентации у деревьев лучшего и среднего роста. Так, суммарная длина стержневых корней и вертикальных ответвлений составляет у деревьев лучшего роста 25,7, среднего 12,7 %.

В строении корневой системы каштана посевного в 10-летнем возрасте преобладают корни второго порядка ветвления. Так, у дерева лучшего роста горизонтальные корни первого порядка составляют 21,7 %, второго 46,7, третьего 10,9, вертикальные ответвления 15,8 %, стержневой корень с ответвлениями первого и второго порядков 4,9 % общей длины скелетных корней.

Стержневые корни каштана проникают на глубину до 3 м. Вместе с тем глубина проникновения стержневых корней дуба черешчатого при совместном произрастании с каштаном составляет 4,2 м.

Так же, как и у других древесных пород, площадь проекций корневых систем каштана значительно превосходит площадь проекции крон. Это положение характеризуется следующими показателями: у дерева лучшего роста площадь проекции кроны составляет 3,14 м 2 , площадь проекции корней 22,04 м 2 , т. е. в 7 раз больше; у дерева среднего роста соответственно 1,76 и 12,6 м 2 , т. е. в 7,2 раза больше.

Интенсивность населенности почвенного пространства скелетными корнями у дерева лучшего роста 6,7, среднего 6,1, отстающего в росте 13,9 м/м 3 .

Горизонтальные корни каштана посевного относительно малосбежистые. Диаметр корней первого порядка на 0,5 относительной длины составляет 34,9 %, что значительно выше, чем у многих древесных пород. Так же, как и у других пород, горизонтальные корни второго порядка у каштана посевного менее сбежисты, чем корни первого порядка.

Если вы нашли ошибку, пожалуйста, выделите фрагмент текста и нажмите Ctrl+Enter .

При планировке сада своей мечты наиболее привлекательным и волнующим является процесс выбора растений. Посадки должны гармонировать со всеми элементами сада. Именно растительность запоминается в саду прежде всего. Нужно учитывать, что у каждого растения есть свои характеристики и склонность к определённому виду почвы. Когда все вопросы с подготовкой почвы проведены, переходим к подбору растений. Это производится с учётом их требований к освещённости, влаге, питательности почвы и принадлежности к климатической зоне. Можно, конечно создать коллекции и сады сложные в уходе, но для этого необходимо сознательное, ответственное решение. Только учитывая вышеперечисленные пункты, растения будут хорошо расти и радовать Вас пышностью зелени и буйством красок. Но, самоё главное правило – начинать работу с растениями с любовью. Было проведено много опытов, доказывающих, что растения реагируют на Ваше отношение к ним.

Наличие широкого ассортимента растений (если конечно Вы не собираете коллекцию) не означает, что сад прекрасен. Основное внимание уделяется внешнему виду, текстуре, форме листьев, цвету, габаритам, времени цветения растений. Не лишним будет ознакомление с видами корневой системы. Эти данные следует учитывать при подготовке посадочных ям и определении местоположения растений.

В садовых центрах растения сейчас продаются в контейнерах (закрытая корневая система). Из таких растений легче составить композицию и высаживать их можно почти круглый год, за исключением периода, когда земля замёрзла. Транспортировать контейнерные растения проще и приживаемость у них лучше. Проверить контейнерное растение или нет легко – достаточно достать растение из контейнера. Ком должен быть переплетён корнями и не разваливаться. Но, если корни вылезли из дренажных отверстий, значит, растение давно не пересаживали и оно будет в угнетённом состоянии (на такие вещи нужно обращать внимание). Крупные экземпляры часто продают в «балотах» — подготовленный корневой ком в мешковине, помещённый в металлическую сетку. Это тоже закрытая корневая система. Мешковина в земле перегнивает за сезон, а сетка разлагается за 3-4 года. Поэтому такие растения высаживаются в сетке, только срезается верхняя часть – это делается для возможности разрастания ствола. Весной и осенью пересаживают и делят растения с открытой корневой системой – такой посадочный материал обходится дешевле, но сокращаются сроки посадки.

Типичные корневые системы древесных растений:
1 – Стержневая неразветвлённая корневая система, основные корни при нормальном развитии очень глубокие (пихта, гинкго двулопастной, лиственница, псевдотсуга, клён красный, клён полевой, клён остролистный, граб, лещина древовидная (медвежий орех), липа мелколистная, вяз, каштан конский, ольха черная, берёза, бук, лиродендрон, тисс ягодный) рис. 1
2 – Стержневая корневая система неразветвлённая в молодости, с возрастом разветвлённая, на нормальных почвах глубокая (лиственница европейская) рис. 2
3 – Глубокая, разветвлённая корневая система. С возрастом стержневой корень разветвляется за счёт нарастания массы боковых корней (дуб черешчатый, рябина, псевдолиственница, боярышник, слива, груша, ясень обыкновенный) рис.3
4 – Стержневая корневая система неразветвлённая в молодости, с возрастом разветвлённая. На нормальных почвах глубокая, на тяжёлых почвах – плоская (сосна обыкновенная) рис. 4
5 – Поверхностная корневая система. В основном, корни очень поверхностные, часто расположенные радиально (берёза бородавчатая, сосна Гриффита, дуб красный, клён, робиния, ива, кипарисовик, туя, тсуга, ель, дёрен, магнолия, сумах) рис. 5

Следует знать, что не все растения переносят влияние корней и кроны других деревьев. Существует ряд растений, которые всё-таки довольно неприхотливы рядом с более могучими соседями. Это: самшит, дерен, лещина, бересклет, плющ, падуб, бирючина, жимолость, пираканта, смородина альпийская, бузина, снежноягодник, тисс, магония, волчеягодник, хеномелес, брусника, барвинок.

Территория наших участков, как правило, небольшая. Поэтому следует знать в лицо растения, которые неуместно использовать на маленьких площадях (если, конечно, не принято решение посадить одно – два крупномерных растений). Виды высоких растений высота который в зрелом возрасте от 4 до 20 метров: пихта одноцветная (15м), кипарисовик лавсона (5м), лиственница (18м), ель сербская (14м), ель колючая (15м), cосна австрийская черная (15м), клён полевой (15м, диаметр кроны 12м), клён обыкновенный (30м), клён серебристый (30м), каштан конский (25м), бук лесной или европейский (25м), ясень (до 35м), дуб черешчатый (40м), дуб красный (до 20м), робиния (12м), ива белая (диаметр кроны и высота 20м), липа европейская (до 40м), липа мелколистная (до 20м).

Но, в настоящее время, наш рынок очень богат карликовыми видами и сортами декоративных растений. С их помощью можно очень красиво оформить даже очень маленькие рокарии и миксбордеры, сделать красивый акцент на альпийской горке, пополнить коллекцию или осуществить одиночную посадку перед окном, или в газоне. При подборе растений очень удобно пользоваться польскими каталогами, продающимися в садовых центрах. Здесь не только помещены фотографии растений, но и указана их форма и размер относительно человеческой фигуры. Глаз могут порадовать карликовые пихты, ели, туи, можжевельники, берёзы, барбарисы, спиреи, колоновидные дубы и рябины, очень много штамбовых форм хвойных и лиственных растений.


&nbsp&nbsp&nbsp

&nbsp&nbsp&nbsp

&nbsp&nbsp&nbsp

&nbsp&nbsp&nbsp

Неплохо было бы знать, что существуют понятия морозостойкости и зимостойкости растений. Морозостойкость – это способность растений выдерживать низкие температуры, свойственные определённой климатической зоне. А зимостойкость – выносливость растений при частом изменении окружающей среды (то резкое похолодание с сильным ветром и морозом, то потепление, то снегопад и т.д.). У каждого вида растений есть ещё свои отличительные характеристики, например: Каштан конский не выходец из наших мест, морозоустойчив и может расти как в солнечном, так и в тенистом месте. Ольха чёрная требует увлажнённой почвы и не переносит известковых почв. Бук лесной и граб хорошо переносят обрезку и требуют свежих почв. Хорошо переносит обрезку и береза, но нужно знать, в какое время это делать, чтобы она не засохла от потери сока, а вообще, это растение неприхотливо. Липа мелколистная не переносит уплотнения почвы. А дуб черешчатый — теплолюбив и очень медленно растёт.

Существует классификация растений по отношению к освещению, кислотности почвы, отношению к влиянию окружающей среды и промышленным выбросам, уплотнению почвы у корней, ветроустойчивые и ветрозащитные растения. Необходимо выделить группы растений, которые переносят кратковременные затопления: клёны полевой, ясенелистный, псевдоплатановый, ольха, арония, берёза, граб, дёрен белый, падуб, магнолия, слива, рододендрон, бузина чёрная, снежноягодник, липа, вяз, рябина, калина, аристолохия, клематис, жимолость, лиственница, ель, сосна обыкновенная, веймутова, туя, кипарисовик. А вот растений, которые перенесут постоянно повышенный уровень вод очень мало: дёрен даст слабый прирост, а метосеквойя потребует длительное время на перестройку, да и не наше это растение.

Тяжёлые глинистые почвы для Белоруссии не редкость. Можно полностью заменить почву на участке, провести дренажные работы, сделать нужный уклон для отвода воды и подсыпать песчаную подушку, но в данном случае, мы говорим о слое почвы 60см. от поверхности в глубину. Для однолетних и травянистых многолетних растений это решение вопроса, а вот для деревьев и высоких кустарников, у которых корневая система идёт в глубину на несколько метров — это помощь, но до тех пор, пока растение молодое. Поэтому, лучше избавить себя от разочарования в будущем и изучить список растений, пригодных именно для Ваших условий. Причём перечень растений довольно большой: клён, ольха, граб, дёрен, лещина, кизильник, боярышник, бересклет, бук, форзиция, ясень, плющ, падуб, дуб, смородина альпийская, шиповник, ежевика, ива, клематис. Из хвойных: кипарисовик, лиственница, микробиота, ель, псевдотсуга. Следует помнить, что некоторые сорта из вышеперечисленных растений могут быть очень прихотливыми, но тут важен индивидуальный подход. А видовые растения спокойно переносят данные условия.

Очень важный показатель – кислотность почвы . В прошлом мы уже говорили о том, что в Белоруссии преобладают кислые почвы, но для хвойных, рододендронов, гортензий и некоторых других растений нужен специальный субстрат. Его необходимо добавлять в посадочную яму и перемешивать с существующим грунтом. Рассмотрим многими любимую гортензию — о физиологическом происхождении смены цветов у этих растений. Как же получить голубые гортензии? Очень важно правильно выбрать сорт. Чистая голубая окраска возможна только у розовоцветного сорта, чьи цветы содержат достаточное количество красящего вещества дельфинидина. У белых цветов этого красящего вещества нет, поэтому они голубыми никогда не станут. Такие тёмно-розовые сорта, как «Гамбург», содержат небольшое количество дельфинидина в своих цветочных клетках. У них доминирует красный цвет, они дадут фиолетовый, что тоже может быть интересно. Только при достаточном внесении в почву алюминия до начала цветения гарантирует получение чистого голубого цвета. Алюминий можно вносить для растений в почву с низким значением pH, т.к. он в достаточной мере разлагается только при значении меньше 5.0 и может быть поглащён растениями. Сульфат алюминия вносят от 1,5 до 5 на м.куб. Гортензия нежного сорта «Букет роз» легко меняет цвет даже при слабокислой почве. Но, следует заметить, что растения с синими цветами гораздо ниже, чем с голубыми и розовыми. Смешанного цвета экземпляры могут быть самыми крупными.

Растения для кислых почв: Хвойные – пихта, кипарисовик, гинкго, можжевельник, ель, микробиота, сосна низкая или кедровый стланик, сосна веймутова, обыкновенная, Гриффита, псевдотсуга, тисс, туя, тсуга. Лиственные – ракитник, дабеция, дейция, лох, эрика, дрок, гортензия, падуб, ива, магнолия, пахисандра верхушечная, виды лапчаток, дуб болотный, красный, некоторый сорта смородины, малины, ежевики, роз, бузина красная, голубика. Рябина, калина, спирея, сирень, дёрен – выдерживают кислые почвы.

Если с влагой и кислотностью нам более-менее понятно, то «включить» солнечный свет в тенистых уголках и с северной стороны строений не получится. Но природа позаботилась и об этом. Если существуют такие условия, значит и растения для них найдутся. Хорошо чувствуют себя без яркого солнца зелёные сорта барбарисов, выносят тень: самшит, граб, дёрен, лещина, кизильник, боярышник, бересклет, бук лесной, голтерия, гамамелис виргинский, плющ, гортензия, падуб, керрия, бирючина, жимолость (цветение будет не обильным), некоторые сорта магнолии, пахисандра, пузыреплодник, пиерис японский (в нашей зоне зимует под укрытием), черёмуха, рододендрон, некоторые сорта крыжовника, шиповник, бузина, рябина, сорта калины, липа крупнолистная, бересклет форчуна, клематис, аристолохия. Из хвойных растений: пихта, виды и сорта елей, кипарисовиков, тсуга, микробиота, туя западная, складчатая, туевик долотовидный.

Необходимо отметить ещё один очень важный момент, на который обычно не обращают внимания – в природе встречаются ядовитые растения , и они широко используются в озеленении. Если в доме есть маленькие дети, то их внимание часто привлекают ягодки на декоративных растениях, они часто обрывают кору с веток или берут в рот части растений. У волчника ядовиты все части растения, а 10-12 ягод – смертельная доза для детей. У бересклета – ядовиты все части, 36 ягод – смертельны для взрослого человека. У падуба – ядовиты плоды и листья, 30 ягод – смертельны для взрослого. У бобовника — все части растения очень опасны, 4 боба – смертельная доза для ребёнка. У сумаха — опасны кора и млечный сок. У можжевельника – ядовиты все части растения, 20грамм – смертельны, особенно опасны концы побегов. Дурман, ландыш, наперстянку тоже относят к ядовитым растениям, но они не так опасны, как вышеперечисленные.

Аллергия – коварное заболевание и необходимо знать аллергены природного происхождения. Самая многочисленная группа аллергенов, проникающих в организм в основном из воздуха и при непосредственном контакте с кожей: пыльца растений (большая часть пыльцы выбрасывается растениями в утренние часы), споры плесневого гриба, мучнистая роса, сок некоторых растений, который выделяется при их повреждении. Отмечается два периода, когда в воздухе постоянно находится пыльца – это весна, когда цветут листопадные деревья и лето, время цветения трав. На этот период можно уехать. Не хочется создавать образ растений-врагов, каждое из нижеперечисленных обладает неповторимыми по красоте свойствами. Лиственные деревья: ива козья, ольха чёрная и серая, тополь, осина, лещина, береза, ясень, жасмин. Газонные травы нельзя доводить до цветения и скашивать вовремя. Злаки и разнотравье: овёс, рожь, пшеница, рис, пырей, тимофеевка, ежа, амброзия, мятлик луговой, плевел, ромашка, овсяница, подорожник, райграс, лисохвост, декоративные злаки, тысячелистник, астры, хризантемы, гелениум. Многие травы цветут во время цветения тополей и именно травы вызывают аллергические реакции, а тополя лишь являются источником пуха. Растения, вызывающие фитодерматозы: крапива, волчье лыко, одуванчик, марь белая, лебеда, полынь горькая, паслен, листья плюща, растения-первоцветы.

​Похожие статьи​

Мочковатая корневая система:
  • ​Ещё нашла информацию такую: Трудно выкорчевывать пни с глубоким стержневым и развитыми боковыми корнями (дуб, сосна, лиственница), легко корчевать деревья с боковыми, поверхностно стелющимися корнями (осина, ольха, ель).​
  • ​Самый простой способ заполнить пространство вокруг деревьев и кустарников — создать под ними зеленый ковер, который закроет оголенные площади не только под крупными деревьями, но и под низкорослыми кустарниками без вреда для них самих. Создают его, конечно, с помощью почвопокровников и близких к ним теневыносливых стелющихся многолетников с декоративными листьями. Кроме декоративного эффекта, зеленые насаждения позволят подавить распространение и развитие сорняков, значительно упростят уход за садом, сэкономив вам достаточно много времени, которое обычно тратится на прополку. Собственно, зеленый ковер может быть не обязательно только зеленым: комбинируя растения с красивой листвой с летниками, высаженными полянками и «латками», можно создавать красочные, подсвечивающие тенистые места изнутри, ковры, которые больше напоминают покрывала в стиле пэчворк.​
  • ​Тсуга канадская​
  • ​Клен ясенелистный​
  • ​Дуб красный​
  • ​Сосна (большинство видов) — менее глубокие на тяжелых почвах​
  • ​Вяз шершавый​
  • ​Яблоня (виды и сорта) — не очень глубокие​
  • ​Лох узколистный — среднеглубокие​
  • ​Клен ложноплатановый​
  • ​Придумывая декоративные композиции из растений, мы обязательно должны учитывать их максимальные размеры. Ведь деревьям и кустарникам свойственно меняться – разрастаться, набирать массу и увеличиваться в размерах. Не менее важно знать и детали «подземной» жизни корневых систем крупных растений. Потому что под землей находятся как бы перевернутые разветвленные кроны. У одних – пирамидальные (стержневая корневая система), у других – почти шаровидные (мочковатая).​
  • ​Сосна, ель, пальма, кипарис​
  • ​Подбирая растения для своего зеленого коврика, обратите внимание на период их декоративности: чем дольше ваши растения будут привлекательными, тем более стабильным и красочным будет оформление вашего сада. Так, если почвопокровники хороши только в активный садовый сезон, то такие вечнозеленые красавцы, как выносливый и неприхотливый, да к тому же и быстро разрастающийся плющ, барвинок, пахисандра, вальдштейния будут укрывать почву не только весной, летом или осенью, но и в зимний период, не теряя свою привлекательность независимо от сезона и погоды, а декоративно-лиственные звезды, такие как хоста, столь эффектны, что отсутствие зимнего наряда легко простить. Верхушечная пахисандра радует глаз листвой сочного зеленого окраса, плотным и пышным ковром резных листьев, под которыми не видно свободного грунта. А вот хоста со своими крупными сердцелистными листочками с пестрыми узорами наполняет тенистые места очарованием и светом. И пусть ее больше ценят именно за декоративность листвы, цветение, которое длится все лето, также очень привлекательно. Барвинок — растение пусть и простое, но такое милое благодаря скромным листьям и удивительно ярким цветкам. Он растет и в тени, и на солнце, долговечен, цветет очень продолжительно и без труда поселится даже под кустарниками. Намного больше пространства потребуется бересклету Форчуна с его мощными побегами, но яркая листва, к зиме меняющая желто-зеленые узоры на розово-зеленые, стоит того, чтобы потеснить прочие культуры. А разбавить зеленое море листьев и привнести в него летние яркие краски помогут тенелюбивые однолетники — бегонии, мимулюс, бальзамины, настурции, некоторые виды мелкоцветных гераней.​
  • ​Туя западная​
  • ​Робиния лжеакация (белая акация) — в зрелости​
  • ​Ель (большинство видов)​
  • ​Черемуха магалебка​
  • ​Груша иволистная​
  • ​Боярышник гладкий​
  • ​Ольха серая — не очень глубокие​
Стержневая корневая система:
  • ​Клен остролистный — не очень глубокие​
  • ​Береза повислая — неглубокие​
  • ​Чем глубже корни, тем более хорошее заземление, следовательно, проводимость зарядов эл. тока — больше, соответственно, молния «предпочтёт» данное дерево другому, при условии, что рядом нет более высоких деревьев, так как на более высоких деревьях больше накапливается статический заряд.​
  • ​Если кустарники можно «оформить» только покрывалом почвопокровных и стелющихся растений с редкими вкраплениями цветущих летников, то под деревьями можно устроить настоящий мини-цветник (если, конечно, речь не идет о груше, липе, дубе, яблоне или вишне с поверхностной корневой системой). Идеальной комбинацией для оформления участков под деревьями считается сочетание многолетников, которые не боятся конкурентов и хорошо развиваются даже в стесненных условиях колыхающихся декоративных трав и тенелюбивых папоротников. Они играют на контрастах, создают эффект пестрого моря и только подчеркивают красоту деревьев-солистов.​
  • ​Черемуха обыкновенная​
  • ​Сосна Уолича​
  • ​Ива (многие виды)​
  • ​Ясень обыкновенный​
  • ​Груша обыкновенная​
  • ​Боярышник круглолистный​
  • ​Ольха черная — часто очень глубокие​
  • ​Клен полевой — не очень глубокие​
  • ​Береза пушистая​
  • ​Я всегда считала, что молния попадает в самые высокие деревья.​
  • ​Одними из лучших растений, способных поселиться в тени, является великолепная наперстянка с ее неповторимыми длинными соцветиями из причудливых колокольчиков, яркая манжетка, импозантный эпимедиум, трогательная функия. Их точно не назовешь незаметными «крохами»! Оригинальный цветущий коврик можно составить из цикламена плющелистного, выпускающего в конце лета розовые головки цветков. Не будет лишней в собрание теневыносливых многолетников и импозантная астильба с ее ажурно-филигранными рыхлыми метелками или аквилегия с изящными цветочками, которая по праву считается растением-бродяжкой. Но порой даже слишком смелые краски для тени нуждаются в балансировке с помощью более сдержанных, но не менее прекрасных растений. Декоративная осока, щитовник отлично «успокоят» цветущие многолетники и создадут пейзажный эффект в приствольном кругу. А вот герани лучше высаживать в рассеянной тени по краю кроны в качестве своеобразной окантовки. Кстати, герань — единственное растение, которое подходит для создания моноковра из высоких многолетников. Ее корневая система настолько компактна, что высадить герани можно даже рядышком с капризными красавицами. Посадите несколько кустиков в приствольном кругу и уже через несколько лет вы получите удивительно выносливый и красочный коврик гераней.​
  • ​Пустующая почва под деревьями и кустарниками выглядит непривлекательно, да и распространяющиеся по свободным участкам сорняки отнимают много времени и сил. Найти решение этой проблемы довольно сложно, ведь, с одной стороны, крона крупных деревьев и кустарников слишком плотна и не обеспечивает достаточного освещения для высадки газона, а, с другой стороны, высаженные растения могут помешать развитию самих главных действующих лиц сада. И чем более густой, плотной кроной обладают деревья и кустарники, чем более поверхностная у них корневая система, тем сложнее задача оформления места вокруг них. Но это вовсе не значит, что решения такой проблемы нет. Среди садовых растений найдется немало очень красивых и неприхотливых многолетников, которые своими корнями не помешают развитию собственно кустарников или деревьев, а также великое множество «легких» почвопокровников, которые не только хорошо чувствуют себя в тени, но и создают благоприятные условия для развития деревьев. Главное — правильно подобрать пышное сопровождение для конкретных видов и сортов деревьев.​
  • ​Тополь китайский​
Поверхностная корневая система:
  • ​Ирга канадская​
  • ​Ясень узколистный​
  • ​Дуб черешчатый​
  • ​Боярышник однопестичный​
  • ​Ольха черная «Империалис»​
  • ​Конский каштан обыкновенный — более или менее​
  • ​Береза черная​
  • ​может просто эти деревья и выше?!​
  • ​В тени огромных деревьев можно даже посадить небольшие цветущие кустарники, например, невысокие рододендроны. Их следует окружать лишь одним растением, ведь скопление разношерстных ковриков будет выглядеть слишком кричаще. К рододендронам, к примеру, можно подсадить полянку дерена канадского, который составит с цветущими красавцами удивительно элегантный дуэт, или контрастно темный плетущийся плющ.​
  • ​Далеко не все деревья «любят» соседство с другими растениями. «Миролюбивые» липа, яблоня, дуб словно созданы для того, чтобы их приствольная зона украшалась пышными растениями и яркими цветами. Эти деревья имеют компактную, не слишком широкую и глубокую корневую систему, которая позволяет высаживать в тени кроны самые разные растения, даже многолетники, активно использующие влагу и питательные вещества грунта. В полной мере к ним же можно причислить и груши с вишнями. Под такими деревьями, которые не откажутся от соседства с другими культурами в приствольном круге, растения для создания как можно более красивого ковра высаживают достаточно плотно, располагая на одном квадратном метре до 12 саженцев почвопокровников, около 7 среднерослых или 3 крупных многолетника.​
  • ​Тополь бальзамический​
  • ​Кипарисовик горохоплодный​
  • ​Багрянник японский​
  • ​Жестер слабительный​
  • ​Боярышник сливолистный​
  • ​Пихта (большинство видов) — глубокие​
  • ​Лжетсуга мензиса​
  • ​Гинкго двухлопастный​
  • ​Толстые корни являются лучшими проводниками, чем мелкие, – в них больше влаги, они имеют большую площадь соприкосновения с землёй.​
  • ​Существует два основных типа корневых систем. У большинства дубов, некоторых сосен (например, жесткой и болотной) и многих других деревьев эта система стержневая: основание ствола переходит в крупный вертикальный корень, который постепенно сужается и ветвится подобно надземной части дерева. Этот главный корень обычно дополняется придаточными, горизонтально расходящимися от основания ствола. В случае мочковатой корневой системы, характерной, например, для ильмов, буков и кленов, у дерева имеются только такие горизонтальные корни, а главный среди них не заметен. Внутри каждого из этих типов наблюдаются многочисленные варианты. Кроме того, деревья одного и того же вида могут образовывать стержневую корневую систему на мощных плодородных почвах и мочковатую – на сырых или каменистых местах.​

supersadovnik.ru

Почвопокровные растения для заполнения пространства под деревьями и кустарниками.

​Намного сложнее оформить зону под такими представителями деревьев, как клен остролистный или береза, ведь их корни располагаются очень широко и развиваются горизонтально, близко к поверхности почвы. Травянистые многолетники у таких деревьев неуместны, а почвопокровникам потребуется помощь: на взрыхленную почву между корнями следует сверху насыпать слой компоста шириной с ладонь с добавкой равной доли садового грунта, высадить растения, замульчировать их крупными опилками или корой и подождать, пока растения приживутся и самостоятельно распространятся. Начинать следует всего с нескольких растений. Озеленение приствольных кругов березы и клена — дело не одного сезона, и главное в нем — запастись терпением и позволить растениям постепенно развиваться самостоятельно. Дважды в год между растениями следует раскладывать новый компост и удвоить подкормки органическими удобрениями, а также обеспечить дополнительный полив в засуху.​

​Тополь белый «Нивея»​

​Клен приречный​

​Бархат амурский​

​Рябина ария​

​Вяз гладкий​

​Робиния лжеакация (белая акация) — в молодости​

​Липа (большинство видов)​

​Клен красный — неглубокие​

indasad.ru

Деревья. Выоские деревья, с минимальной корневой системой, разрастающейся вертикально?

UNESCO

​Потому, что более развитая корневая система способствует скоплению на дереве большего заряда, который и притягивает молнию​
​Насчёт диаметра -как правило, считается, что диаметр корневой системы приближен к диаметру кроны.​
​Но есть среди деревьев и такие растения, которые создают очень сильную тень, в которой могут прижиться лишь единицы растений, да и этих соседей они «отпугивают», выпуская ядовитые вещества. Так, лещина и каштан в листьях содержат яды, которые после опадания попадают в грунт и подавляют рост растений в приствольной зоне. Робиния еще более коварна: яды выделяют не только листья, но и корни. Рядом с этими растениями пышный ковер не создашь.​

«Посадить дерево, построить дом, родить сына…» Испокон веков жизнь неразрывно связана с жизнью человека. Как же разместить верных спутников, чтобы они отменно себя чувствовали и радовали глаз долгие годы?

Традиция высаживать дерево в значимые для человека даты уходит своими корнями в доисторические времена. Наши предки почитали «корифеев» растительного мира и приписывали им магические свойства. Особенно в этом преуспели друиды. По сей день считается добрым знаком посадить дерево на свадьбу, в честь рождения ребенка и после обустройства собственного семейного гнезда: живой оберег защищает от зла, дарит силы и здоровье. Целые аллеи поднимают к небу ветви в память о выдающихся людях… Что уже говорить о — редкий хозяин откажется высадить на участке хотя бы одно деревце. Но в наше время в приоритете практическая ценность этих представителей флоры — они являются ключевыми элементами . Так, деревья:

  • делают сад трехмерным,
  • зонируют,
  • прикрывают несимпатичные
  • или, наоборот, служат яркими акцентами
  • и, конечно, дарят благодатную тень.
Раньше в деревнях почти возле каждого дома высились раскидистые великаны — , или . Сегодня же далеко не всякий обладатель земельных «соток» может позволить себе пригласить на ПМЖ в сад крупногабаритных красавцев. К счастью, за последние десятилетия стараниями селекционеров появилось немало компактных сортов с колонновидными или . Деревья с каждым годом становятся красивее, а их аура, оберегающая сад, — сильнее.

Осенью листья клена дланевидного (Acer palmatum) ‘Aureum’ приобретают оранжево-красный оттенок. Это низкорослое дерево достигает всего 3 м в высоту, поэтому отлично подходит для посадки в маленьком саду.


Береза Жакмона и клен дланевидный «Aureum»

Лиственный навес платана кленолистного (Platanus acerifolia) дарит желанную прохладу в жаркие летние дни.


Листва сливы мелкопильчатой (Prunus serrulata) осенью окрашивается в красновато-желтые тона. Растению в саду требуется много «личного пространства», поскольку его крона в диаметре достигает 5 м.


Выбирая зеленого спутника , проанализируйте его деко-потенциал: впишется ли «новичок» в облик сада? Например, деревья с живописно ниспадающими ветвями, такие как береза повислая (Betula pendula) ‘Youngii’ или бук лесной (Fagus sylvatica) ‘Purpurea Pendula, — идеальные кандидаты для участка в романтическом и природном стиле. А деревья с геометрическими кронами — выигрышный вариант для садов в современном стиле. Они занимают мало места и, как правило, даже без сохраняют форму.

Бесспорными фаворитами сада станут деревья, сохраняющие декоративность круглый год благодаря яркой листве и коре, пышному цветению, обильному плодоношению ( , рябина).

Соблюдаем дистанцию

Дерево у дома — классика садового «жанра». Но чтобы этот тандем был гармоничным, при посадке нужно тщательно выверять дистанцию. Не стоит высаживать крупногабаритные деревья у самой стены дома . Ведь даже виды с узкими кронами, такие как вишня мелкопильчатая, или сакура ‘Amanogawa’, требуют немало «личного пространства».

Для узких палисадников лучше выбирать растения, которые хорошо переносят (например, граб обыкновенный (Carpinus betulus) , ведь их легко «подогнать» под нужные размеры.


Еще один важный момент — особенности корневой системы . Рядом с вымощенными Приствольный круг дерева не самое подходящее место для посадки других растений

Конкурировать с этими единоличниками за воду и питательные вещества смогут разве что теневыносливые и засухоустойчивые травянистые многолетники , такие как:

  • воробейник (Lithospermum),
  • (Duchesnea),
  • эпимедиум (Epimedium),
  • (Symphytum),

а также выносливые декоративные травы и карликовые кустарники , например:
  • осока теневая (Carex umbrosa),
  • (Euonymus fortunei),
  • пахизандра (Pachysandra).

Несколько проще найти спутников для катальпы, ликвидамбара, гинкго, декоративной яблони и сакуры. Под ними можно разбить цветник:

Их не любят вредители

Липу крупнолистную (Tilia platyphyllos) часто атакует листовая . В результате на листьях появляется липкая падь, из-за которой отдыхать под деревом становится очень неприятно. Если вы решили посадить в саду такое дерево, отдайте предпочтение липе серебристой (Tilia tomentosa): она устойчивее к этой напасти.


На листьях липы появляется липкая падь А вот клен полевой (Acer campestre) часто поражает . Ситуацию спасет выбор сорта, менее подверженного этой болезни, — ‘Elsrijk’.

Любите конский каштан обыкновенный (Aesculus hippocastanum), но созерцание покоричневевших из-за моли-пестрянки листьев вас в восторг не приводит? Поселите своем саду более низкорослый конский каштан мясо-красный (Aesculus х carnea) ‘Briotii’ с красными цветками — он не по вкусу вредителю.

Фото: Annette Timmermann, Gartenfoto.eu/Martin Staffler, GAP Gardens, Marion Nickig, Ursel Borstell, GBA/Staffler, D. van Dieken, F. Schuberth, F. Siemens, Alamy/Zoonar, Robert Mabic. Постановка: W. Bohlsen/K. Nennstiel/M. Schacht.A., Georg/K. Wiegert.
Рисунки: MSG/Claudia Schick.

Правильно развивающаяся корневая система дерева — это залог успешного прохождения растением всего жизненного цикла. Поскольку нормальное развитие корня обеспечивается качеством грунта, причем верхнего и нижнего его слоев в которые прорастают корни, то уход за корнями растений на практике заключается в уходе за грунтом, являющимся средой в которой происходит рост и развитие корневой системы. Знать, как именно подземная часть каждого из видов плодовых деревьев располагается в почве, для садовода очень важно — эта информация позволит осуществлять правильный уход за растениями, соблюдать глубину обработки грунта, которая не приводила бы к повреждению корней, особенно всасывающих. Зная область периферии приствольного круга, садовод сможет рационально вносить удобрения — они сразу окажутся в зоне расположения наиболее активных корней дерева а также правильно производить корневой полив.

Строение корневой системы

Корневая система растений, в частности плодовых деревьев — это их подземная часть, включающая корневую шейку, скелетные корни и обрастающие. Место перехода корня в стебель называется корневой шейкой, окраску она имеет переходную, цвет между наземной и подземной частью растения изменяется плавно. Иметь настоящую коневую шейку могут только деревья, которые выросли из семян, растения, размноженные путем черенкования или отводков, имеют ложную корневую шейку. При высадке саженцев плодовых деревьев следует помнить, что корневая шейка должна располагаться над поверхностью почвы.

В образовании скелетной структуры корня принимают участие первичный корень и все отходящие от него ответвления. Назначение скелетных корней — снабжение дерева питательными веществами в теплое время года и хранение запасов питательных веществ зимой. Также скелетные корни служат для укрепления растения в почве. Даваемая ними поросль — это естественный способ размножения растений.

Корневая мочка дерева формируется их обрастающих корней, она представляет собой наиболее активную часть системы, служит для всасывания и поглощения влаги и питательных веществ из грунта и передачи их скелетным корням.

Типы корневых систем деревьев по размещению в грунте могут быть:

  • вертикальными
  • горизонтальными.

Размеры корневой системы — от каких факторов они зависят

Если условия роста удовлетворительные, то размеры корневой системы дерева могут быть достаточно большими. У плодовых деревьев может наблюдаться проникновение корней в глубину на 3-4 м, в ширину они могут разветвляться на 5-8 м. Но в большинстве случаев наиболее активная часть корневой системы располагается на небольшой глубине, порядка 0,2-0,8 м.

Следует отметить, что рост корневой системы плодовых деревьев — явление неравномерное, на протяжении года можно наблюдать две волны усиленного роста: осенью и весной. Интересно, что весной раньше оживает наземная часть дерева, осенью — сначала прекращается рост побегов, затем осыпаются листья, рост корней продолжается на протяжении некоторого периода после листопада.

Стремительность увеличения размеров подземной части дерева зависит от температуры почвы, ее насыщенности влагой и воздухом, питательными веществами. Оптимальной для роста считается температура грунта от +7 С до +20 С, при снижении температуры ниже 0 или повышении до +30 С рост прекращается. Корни кустарников и деревьев страдают от сильного понижения температуры в большей степени чем крона. Поэтому в морозные зимы следует укрывать прикорневой участок торфом, снегом, ветками ели.

Уровень насыщенности почвы кислородом во многом зависит от рыхлости грунта, не лучшим образом на него сказывается и чрезмерное увлажнение, особенно застоявшаяся вода. Угнетению роста корней способствует недостаток или избыточное количество азотистых соединений в грунте. Полезны для дерева калий и фосфор — они стимулируют ветвление корней, а кальций придает прочность. Размеры корневой системы деревьев также зависят от вида подвоя. Способствовать увеличению массы корней ниже пахотного горизонта можно путем определенных агротехнических приемов, к примеру — плантажной вспашки.

Обычно глубина залегания корневой системы плодовых деревьев — от 20 до 60 — 75 см. Что касается горизонтального направления, то они намного превышают проекции кроны на грунт. Коревая система слив и вишен имеют подобный характер залегания.

Яблоня

Корневая система яблони несколько отлична, основная масса корней находится на глубине от 50 до 60 см, некоторые группы корней проникают значительно глубже, до 4 м. Для северных областей характерно более мелкое залегание корневой системы. К примеру, в том случае, если почва сырая и тяжелая, то глубина может равняться всего 20-25 см. Но для климатической зоны Северного Кавказа этот показатель составит порядка 7 м, если радиус кроны такой яблони будет равняться 1,5 м, то боковые корни могут быть распростертыми в горизонтальном направлении в радиусе примерно 3.5 м.

Глубина залегания сетки мелких корней для такого дерева будет находиться в пределах 50-60 см.

Корневая система груши — особенности


Грушевое дерево имеет вертикальную и горизонтальную корневые системы, корни первой уходят на значительную глубину и практически не имеют ответвлений, корни второй, параллельные к поверхности грунта, разветвлены очень сильно, но при этом они имеют компактное расположение и за пределы проекции кроны выходят незначительно. Горизонты залегания корневой системы грушевых деревьев находятся в более глубоких горизонтах, чем корни яблонь. Именно по этому груша не склонна давать поросль, это явление значительно чаще встречается у яблонь.

Наибольшее количество корней груши залегает на глубине от 20 см до 160 см, а скелетные корни могут прорастать на глубину до 5 м. У груши с округлой кроной корневая система как правило шире и гуще, чем у деревьев пирамидальной формы. На активность роста и размещения корневой системы в пространстве оказывают влияние:

  • подвой,
  • особенности привитого сорта,
  • экологические условия,
  • возраст дерева,
  • климатические условия,
  • правильность посадки.

Из особенностей груши следует также вспомнить о том, что при пересадке она очень болезненно реагирует на подрезку корней. Чувствительная к состоянию корневой системы крона начинает полноценно развиваться только на второй год после пересадки растения, и то в случае восстановления корневой системы. Деревцо с сильно поврежденными обрастающими корнями практически обречено на гибель.

Каким породам плодовых деревьев следует отдавать предпочтение


Многочисленные исследования показывают, что размеры корневой системы плодовых деревьев, начиная со второго года и далее примерно в 1,5 — 2 раза превышает проекцию диаметра кроны. Причем такая пропорция наблюдается у деревьев разных пород, произрастающих в разных климатических условиях. Вместе с тем, со смещением зоны садоводства на юг наблюдается углубление залегания подземной части. Но при высоком уровне грунтовых вод или наличии в почве плотных галечных слоев деревья южных районов также могут иметь поверхностное расположение корневой системы.

Выбирая породу дерева следует отдавать предпочтение такой, которая имеет равномерное по окружности залегание корней, максимально глубокое и широкое, позволяющее получать максимальное количество влаги и питательных веществ из грунта. Удовлетворяющее таким требованиям растение будет отличаться высокой морозоустойчивостью и устойчивостью к засухам. Кроме того, срок жизни таких растений будет более продолжительным, а их плодоношение будет отличаться регулярностью. Также при посадке сада следует учитывать, какая корневая система будет у деревьев посаженных рядом — еще Дарвином доказано, что между растениями одного и того же вида существует острая конкуренция при совместном произрастании, но у растений разных видов она отсутствует. Также более активное распространение корней будет наблюдаться в сторону роста более слабого соседствующего дерева.

Корневая система саженцев

Поскольку развитие корневой системы дерева определяет продолжительность его жизни и качество плодоношения, то при покупке саженцев следует обращать пристальное внимание на корешки. Покупая деревце с открытой корневой системой нужно убедиться в ее достаточной развитости и густоте. Кончики корешков должны иметь белесый оттенок — такие растения были выкопаны недавно и рост их корней продолжается.

Не следует покупать деревца:

  • с почерневшими и присохшими корнями,
  • с наростами на корнях,
  • с искривленными, деформированными корнями.

С осторожностью следует относиться к деревцам с вялой или сухой листвой — возможно растения держали неприкопанными и их приживаемость от этого могла существенно снизиться.

 

Как укрепить склоны. У каких растений стержневая корневая система примеры Растения с поверхностной корневой системой для сада

Создавая сад, важно не только составить композицию из дорожек и растений, где будут гармонично сочетаться все детали, цвет, фактура и пропорции. Важно учесть биологические особенности растений, их размеры и предпочтения в количестве солнечного света, поливе и конечно в грунте. В идеальном же саду тщательно просчитана и подземная часть всех насаждений. То есть растения не только получают необходимые условия для роста но и корни соседствующих растений развиваются на разных уровнях, полностью заполняя всю глубину грунта и не конкурируя за пространство под землей.

По форме различают два основных типа корневых систем: мочковатую и стержневую. У растений со стержневой корневой системой хорошо развит главный корень, который заметно выделяется на фоне других корней. В мочковатой корневой системе главный корень почти незаметен в общей массе, либо вообще отсутствует как таковой. Все корни такого растения ветвисты и равномерно развиты, создавая почти комок, с достаточно большой поглощающей поверхностью. В то же время мочковатые корневые системы могут быть поверхностными и находиться у самой кромки грунта, разрастаясь в ширину, либо уходить в глубину, разрастаясь во всех направлениях.

Не зависимо от размеров участка важно учитывать размеры будущего растения, будет это небольшой куст, деревце с кроной до двух метров в ширину, либо настоящий исполин в будущем достигающий диаметра более двадцати метров. Конечно особенно остро неудачный выбор будет сказываться на небольших площадях. Существуют общие нормативы по размещению кустарников и деревьев на придомовых территориях. Деревья не рекомендуется сажать ближе 5 метров от дома, кустарники ближе 1,5 м.

Сильные корни способны повредить не только строения и их фундаменты, но и инженерные сооружения, так советуют отступать 1,5 -1 м от проложенных канализационных и прочих труб при посадке деревьев и кустарников. Это общие пожелания, в зависимости от особенностей корневой системы того или иного растения это расстояние можно сократить.

Деревья и кустарники со стержневой корневой системой можно расположить значительно ближе. При их размещении самым неудачным будет расположение прямо над коммуникациями. Так как их главный корень растет строго вертикально, это создаст не только проблемы с коммуникациями, но и серьезно навредит самому растению.

Очень важно сохранять дистанцию с деревьями и кустарниками с мочковатой поверхностной корневой системой. Они могут повредить сооружения коммуникации и нарушить плоскости дорожек.

Стержневую корневую систему имеют Боярышник гладкий, круглолистный, однопестичный и сливолистный, Вязы гладкий, мелколистный и шершавый, Груша обыкновенная и иволистная, Жестер слабительный, Рябина, большинство сосен особенно на легких почвах, Черемуха магалебка, Ясень обыкновенный и узколистный.

Относительно глубокую мочковатую корневую систему имеют пушистая и черная Березы, Гинкго билоба, Клены ложноплатановый, остролистный, полевой, Лох узколистный, Ольха серая, а так же яблони. И очень глубокие корни имеют Лиственница, Ольха черная, Орех черный, Сосна обыкновенная, кедровая, Тополь лавролистный и Пихта.

К растениям с мочковатой корневой системой так же относятся Багрянник японский, Бархат амурский, Грабы, Дерены, Дуб красный, большинство Елей, многие Ивы, Ирга канадская, Клены красный, приречный, серебристый и ясенелистный, конский Каштан, Липы, Магнолия, Тсуга канадская и Псевдотсуга мензиса, Рододендрон, Робиния лжеакация, Сосна Уолича, Тис ягодный, Тополи китайский, бальзамический, белый ‘Нивея’, берлинский, Черемуха обыкновенна, Лещина. А особенно осторожно следует относится к Березе повислой, Букам, черешчатому Дубу, Липе крупнолистной и Ореху грецкому. Они обладают мощными корнями и зачастую быстрым ростом.

Не смотря на быстрый рост и поверхностную корневую систему можно не опасаясь сажать очень близко к дорожкам и строениям например Туи, так как они имеют очень компактную корневую систему. Даже при росте более двух метров корневой ком может составлять всего около метра в диаметре. Так же компактную корневую систему имеют Жимолость Маака, Лещина обыкновенная, Липа плоскостная, Пихта одноцветная, Псевдотсуга Мензиса, Слива китайская, Рябины, тис ягодный, Яблоня Недзведского. Так же следует учесть скорость роста и габариты растения, к примеру Сосна горная «Винтер голд» в десятилетнем возрасте не превышает метра в ширину и лишь 0,5 метра в высоту, а по этому не будет угрожать мощению и стенам дома, даже размещенная впритык к ним.

На печать

Людмила Левитина 11.03.2014 | 6898

Как бы ни хотелось наслаждаться видом цветущих или с сочными плодами веток, заглядывающих прямо в окно, высаживать деревья рядом с домом нужно правильно.

Деревьям и кустарникам свойственно разрастаться и набирать массу. Поэтому перед посадкой выясните максимальную высоту взрослого растения и очертания его кроны, иначе зеленый массив может полностью заслонить вам обзор. Также хорошо подумайте прежде, чем высаживать рядом с домом ветровальные породы (в частности, ель, березу и бук),а – при сильном ветре и урагане они могут представлять реальную угрозу вашему жилищу. Порода важна с точки зрения природного освещения здания: к примеру, много тени создают вечнозеленые деревья. Значимы стороны света: скажем, дерево, посаженное на востоке, по утрам бросает на дом тень.

Вредоносные корни

Самый главный параметр, который необходимо учитывать при посадке крупных растений рядом с жилыми постройками, – их корневая система. Корни могут повредить фундамент. Вытягивая влагу из земли и вызывая просадку грунта, корни рано или поздно приводят к появлению трещин на стенах и осадке здания. Преимущественно это касается мелко заглубленных фундаментов.

Сопротивляясь ветру, дерево создает в корнях силу натяжения. Трубы, оплетенные и закупоренные ими, тоже оказываются под воздействием этой силы и, в конце концов, ломаются. Особенно подвержены врастанию корней старые асбоцементные и глиняные трубы. Крупные корни способны ломать неэластичные трубы и проникать в места соединений, закупоривая водосток.

Как исправить ситуацию?

Если ситуация зашла в тупик, трубы коммуникаций и дренажа придется менять, а вот фундамент можно спасти. Заглубите вдоль стены два листа ацэида на 1-1,5 метра в зоне корневой системы и получите «зону скольжения», которая сделает фундамент и дерево независимыми друг от друга. Если вы срубите растение, это будет чревато последствиями, особенно если дерево старое. Устоявшаяся за годы земля по мере впитывания влаги, которая ранее отбиралась корневой системой, начнет разбухать и произойдет пучение грунта. Это, в свою очередь, вызовет напряжение в фундаменте, что вновь приведет к появлению в нем трещин.

Лучший способ избежать неприятностей – предупредить их. При посадке выдерживайте расстояние: от наружных стен здания дерево должно находиться не ближе 5 метров, кустарники – 1,5-2 метров. От подземных сетей (газ, водопровод, канализация) до посадочных ям должно быть, соответственно, не менее 2 и 1-1,5 метров.

Уточните форму и особенности развития корневой системы растения. Так, у деревьев и кустарников со стержневой системой один или несколько основных корней уходят в землю очень глубоко, и это делает их первыми «врагами» коммуникаций. К таковым относятся сосна обыкновенная, некоторые виды груши, боярышника, ясеня и рябины.

У растений с мочковатой системой корни распространяются менее глубоко, зато разрастаются вширь, то есть охватывают большее пространство для повреждения фундамента. Кроме того, среди этой группы много лиственных пород (береза, клен, липа, ольха, яблоня), которые при посадке ближе рекомендуемого расстояния могут засорять листьями водостоки.

Стержневая корневая система – угроза не только фундаменту, но и проложенным вдоль стен дома до-рожкам, так как такие корни могут врастать в их песчано-гравийное основание и приподнимать плитки.

Этого можно ожидать от большинства видов ели и ивы, ирги канадской, клена серебристого, тополя китайского, черемухи обыкновенной и туи западной. Туи выделяют в почву через корни слабые органические кислоты, которые со временем также могут способствовать повреждению фундамента. Чтобы оттянуть срок такого воздействия, позаботьтесь о хорошей гидроизоляции.

Распространенная формула гласит, что по форме и размерам корневая система является зеркальным отражением кроны. Другими словами, колонновидная крона подразумевает стержневой корень, шаровидная – мочковатую и поверхностную системы. Однако эта формула не универсальна. Есть растения с корневой системой смешанного типа, допустим, клен остролистный. Иногда корни занимают меньшую площадь, чем очертания кроны (вишня войлочная), или в несколько раз превышают последнюю (взрослый орех грецкий). При раскидистых ветвях корневая система может быть стержневой (дуб черешчатый), а при колонновидной кроне – поверхностной (некоторые сорта ели обыкновенной). Более того, корневая система со временем может меняться: к примеру, у молодой робинии она мочковатая, а у зрелой – поверхностная.

Итак, руководствуйтесь при выборе дерева или кустарника индивидуальным подходом. В том числе создавайте благоприятные для растения условия – в первую очередь, тип почвы и освещенность. А если хотите полностью обезопасить фундамент и коммуникации, поставьте у стен дома кадки с миниатюрными деревцами и кустарниками.

На печать

Сегодня читают

Теплицы Теплица «Кремлевская» – экспресс-выращивание овощей на вашем огороде

Пока рассада на вашем подоконнике еще подрастает, и дачный сезон не открыт, есть время подумать о том, какую теплицу для…

Корень, являясь важнейшим органом, выполняет ряд незаменимых функций и достаточно разнообразен по особенностям строения. Без него жизнь растительных организмов практически была бы невозможна. В нашей статье подробно будет рассмотрена мочковатая у каких растений она развивается, какие характерные черты имеет и как помогает адаптироваться организмам к постоянно меняющимся условиям окружающей среды.

Что такое корень

Корень представляет собой подземный орган растения. Очевидно, что у растений он не в единственном числе. И действительно, все корни одного организма отличаются по внешнему виду и особенностям развития. Различают три типа подземной части растений: главный, боковой и придаточный. Различить их не составит особого труда. Главный корень у растения всегда один. Он выделяется на фоне остальных размером и длиной. На нем растут боковые корни. Они достаточно многочисленны. А если корни растут прямо от побега, то они являются придаточными.

Функции корня

Без корня растение погибнет, поскольку его функции действительно жизненно важные. Прежде всего, это закрепление организмов в почве, обеспечение минерального питания и восходящего тока воды. При необходимости многие растения образуют Например, свекла, морковь и редис формируют корнеплоды. Это утолщения главного корня. В них накапливаются вода и запас необходимых веществ для переживания неблагоприятных условий.

Типы корневых систем

Корня одного типа растению недостаточно. Ведь от функционирования этого органа зависит жизнь всего организма. Поэтому у растения формируются корневые системы, состоящие из нескольких типов подземных органов. Они более эффективны. Основные типы корневых систем — это стержневая и мочковатая. Их основное отличие заключается в особенностях строения. К примеру, мочковатую корневую систему отличает маленькая глубина проникновения, а стержневая, наоборот, позволяет растениям получать воду со значительных глубин.

Стержневая корневая система

Само название данной структуры характеризует особенности ее строения. У нее есть ярко выраженный главный корень. Этим стержневая корневая система отличается от мочковатой. Благодаря этому растения, обладающие данной структурой, способны доставать воду с глубины в несколько десятков метров. От главного корня отходят боковые, что увеличивает поверхность всасывания.

Строение мочковатой корневой системы

Мочковатая корневая система состоит только из корней одного типа — придаточных. Они растут прямо от надземной части растения, поэтому образуют пучок. Обычно все они одной длины. Причем главный корень в начале развития все-таки вырастает. Однако впоследствии он отмирает. В результате остаются только те корни, которые отрастают от самого побега. Такой пучок в большинстве случаев достаточно мощный. Попробуйте вырвать руками растение пшеницы из влажной почвы — и вы увидите, что для этого необходимо приложить значительную силу. Иногда на придаточных корнях могут развиваться и боковые, что еще больше увеличивает диаметр, занимаемый данной системой.

Какие растения имеют мочковатую корневую систему

В процессе эволюции данная структура впервые появляется у представителей высших споровых растений — папоротниковидных, плаунов и хвощей. Поскольку у большинства из них тело представлено подземным видоизменением побега, а именно корневищем, от него отрастают придаточные корни. Это большой шаг вперед в филогенезе растительных организмов, поскольку водоросли и другие представители споровых имели только ризоиды. Эти образования не имели тканей и выполняли лишь функцию прикрепления к субстрату.

Имеют и все растения, которые относятся к классу Однодольные. Наряду с отсутствием камбия, дуговым или и другими признаками, это является их систематическим признаком. Данный класс представлен несколькими семействами. Например, у Лилейных и Луковых образуется характерное Это утолщенный подземный стебель, в котором запасаются вода и все необходимые минеральные вещества. Он называется луковица. От нее и отрастают пучки придаточных корней. Рис, пшеница, кукуруза, рожь, ячмень являются представителями Для них также характерна мочковатая корневая система. Примеры этой структуры — это также георгин, аспарагус, батат, чистяк. Их придаточные корни в значительной степени утолщены и приобретают клубневидную форму. В них также накапливаются питательные вещества. Называются такие видоизменения корневыми клубнями. Опорные, дыхательные, присоски и прицепки также отрастают от побега. Поэтому их также можно считать видозменением мочковатой корневой системы. Например, лианы при помощи корней-прицепок могут расти даже на вертикальной поверхности. А орхидеи впитывают влагу прямо из воздуха. Это осуществляют придаточные дыхательные корни. Особое видоизменение образуется у кукурузы. Это опорные корни. Они окружают нижнюю часть стебля и поддерживают мощный побег с тяжелыми плодами-початками.

Преимущества и недостатки мочковатой корневой системы

Мочковатую корневую систему имеют растения, которым не приходится добывать влагу со значительной глубины. Это в значительной степени отличает ее от другой подобной структуры — стержневой. В ней хорошо развит главный корень, способный проникать на десятки метров вглубь почвы. Эта характерный признак для всех растений класса Двудольные. Но у мочковатой корневой системы есть и преимущества. К примеру, она способна занимать значительную площадь, что увеличивает поверхность всасывания. У пшеницы мочковатая корневая система в диаметре занимает до 126 см с длиной до отметки 120. Степень развития данной структуры полностью зависит от условий окружающей среды. В рыхлой почве у кукурузы придаточные корни могут разрастаться в радиусе 2 м, у яблони до 15 и более. При этом и глубина проникновения вполне значительна. У некоторых сорняков она достигает 6 м. Поэтому от них так сложно избавиться. Если же почва плотная, а содержание кислорода в ней недостаточно, то практически все придаточные корни располагаются в ее поверхностном слое.

Итак, мочковатая корневая система имеет ряд характерных особенностей. Она характерна для растений класса Однодольные: семейств Злаковые, Луковые и Лилейные. Данная структура состоит из которые отрастают от побега пучком, занимая значительную площадь.

При планировке сада своей мечты наиболее привлекательным и волнующим является процесс выбора растений. Посадки должны гармонировать со всеми элементами сада. Именно растительность запоминается в саду прежде всего. Нужно учитывать, что у каждого растения есть свои характеристики и склонность к определённому виду почвы. Когда все вопросы с подготовкой почвы проведены, переходим к подбору растений. Это производится с учётом их требований к освещённости, влаге, питательности почвы и принадлежности к климатической зоне. Можно, конечно создать коллекции и сады сложные в уходе, но для этого необходимо сознательное, ответственное решение. Только учитывая вышеперечисленные пункты, растения будут хорошо расти и радовать Вас пышностью зелени и буйством красок. Но, самоё главное правило – начинать работу с растениями с любовью. Было проведено много опытов, доказывающих, что растения реагируют на Ваше отношение к ним.

Наличие широкого ассортимента растений (если конечно Вы не собираете коллекцию) не означает, что сад прекрасен. Основное внимание уделяется внешнему виду, текстуре, форме листьев, цвету, габаритам, времени цветения растений. Не лишним будет ознакомление с видами корневой системы. Эти данные следует учитывать при подготовке посадочных ям и определении местоположения растений.

В садовых центрах растения сейчас продаются в контейнерах (закрытая корневая система). Из таких растений легче составить композицию и высаживать их можно почти круглый год, за исключением периода, когда земля замёрзла. Транспортировать контейнерные растения проще и приживаемость у них лучше. Проверить контейнерное растение или нет легко – достаточно достать растение из контейнера. Ком должен быть переплетён корнями и не разваливаться. Но, если корни вылезли из дренажных отверстий, значит, растение давно не пересаживали и оно будет в угнетённом состоянии (на такие вещи нужно обращать внимание). Крупные экземпляры часто продают в «балотах» — подготовленный корневой ком в мешковине, помещённый в металлическую сетку. Это тоже закрытая корневая система. Мешковина в земле перегнивает за сезон, а сетка разлагается за 3-4 года. Поэтому такие растения высаживаются в сетке, только срезается верхняя часть – это делается для возможности разрастания ствола. Весной и осенью пересаживают и делят растения с открытой корневой системой – такой посадочный материал обходится дешевле, но сокращаются сроки посадки.

Типичные корневые системы древесных растений:
1 – Стержневая неразветвлённая корневая система, основные корни при нормальном развитии очень глубокие (пихта, гинкго двулопастной, лиственница, псевдотсуга, клён красный, клён полевой, клён остролистный, граб, лещина древовидная (медвежий орех), липа мелколистная, вяз, каштан конский, ольха черная, берёза, бук, лиродендрон, тисс ягодный) рис. 1
2 – Стержневая корневая система неразветвлённая в молодости, с возрастом разветвлённая, на нормальных почвах глубокая (лиственница европейская) рис. 2
3 – Глубокая, разветвлённая корневая система. С возрастом стержневой корень разветвляется за счёт нарастания массы боковых корней (дуб черешчатый, рябина, псевдолиственница, боярышник, слива, груша, ясень обыкновенный) рис.3
4 – Стержневая корневая система неразветвлённая в молодости, с возрастом разветвлённая. На нормальных почвах глубокая, на тяжёлых почвах – плоская (сосна обыкновенная) рис. 4
5 – Поверхностная корневая система. В основном, корни очень поверхностные, часто расположенные радиально (берёза бородавчатая, сосна Гриффита, дуб красный, клён, робиния, ива, кипарисовик, туя, тсуга, ель, дёрен, магнолия, сумах) рис. 5

Следует знать, что не все растения переносят влияние корней и кроны других деревьев. Существует ряд растений, которые всё-таки довольно неприхотливы рядом с более могучими соседями. Это: самшит, дерен, лещина, бересклет, плющ, падуб, бирючина, жимолость, пираканта, смородина альпийская, бузина, снежноягодник, тисс, магония, волчеягодник, хеномелес, брусника, барвинок.

Территория наших участков, как правило, небольшая. Поэтому следует знать в лицо растения, которые неуместно использовать на маленьких площадях (если, конечно, не принято решение посадить одно – два крупномерных растений). Виды высоких растений высота который в зрелом возрасте от 4 до 20 метров: пихта одноцветная (15м), кипарисовик лавсона (5м), лиственница (18м), ель сербская (14м), ель колючая (15м), cосна австрийская черная (15м), клён полевой (15м, диаметр кроны 12м), клён обыкновенный (30м), клён серебристый (30м), каштан конский (25м), бук лесной или европейский (25м), ясень (до 35м), дуб черешчатый (40м), дуб красный (до 20м), робиния (12м), ива белая (диаметр кроны и высота 20м), липа европейская (до 40м), липа мелколистная (до 20м).

Но, в настоящее время, наш рынок очень богат карликовыми видами и сортами декоративных растений. С их помощью можно очень красиво оформить даже очень маленькие рокарии и миксбордеры, сделать красивый акцент на альпийской горке, пополнить коллекцию или осуществить одиночную посадку перед окном, или в газоне. При подборе растений очень удобно пользоваться польскими каталогами, продающимися в садовых центрах. Здесь не только помещены фотографии растений, но и указана их форма и размер относительно человеческой фигуры. Глаз могут порадовать карликовые пихты, ели, туи, можжевельники, берёзы, барбарисы, спиреи, колоновидные дубы и рябины, очень много штамбовых форм хвойных и лиственных растений.


&nbsp&nbsp&nbsp

&nbsp&nbsp&nbsp

&nbsp&nbsp&nbsp

&nbsp&nbsp&nbsp

Неплохо было бы знать, что существуют понятия морозостойкости и зимостойкости растений. Морозостойкость – это способность растений выдерживать низкие температуры, свойственные определённой климатической зоне. А зимостойкость – выносливость растений при частом изменении окружающей среды (то резкое похолодание с сильным ветром и морозом, то потепление, то снегопад и т.д.). У каждого вида растений есть ещё свои отличительные характеристики, например: Каштан конский не выходец из наших мест, морозоустойчив и может расти как в солнечном, так и в тенистом месте. Ольха чёрная требует увлажнённой почвы и не переносит известковых почв. Бук лесной и граб хорошо переносят обрезку и требуют свежих почв. Хорошо переносит обрезку и береза, но нужно знать, в какое время это делать, чтобы она не засохла от потери сока, а вообще, это растение неприхотливо. Липа мелколистная не переносит уплотнения почвы. А дуб черешчатый — теплолюбив и очень медленно растёт.

Существует классификация растений по отношению к освещению, кислотности почвы, отношению к влиянию окружающей среды и промышленным выбросам, уплотнению почвы у корней, ветроустойчивые и ветрозащитные растения. Необходимо выделить группы растений, которые переносят кратковременные затопления: клёны полевой, ясенелистный, псевдоплатановый, ольха, арония, берёза, граб, дёрен белый, падуб, магнолия, слива, рододендрон, бузина чёрная, снежноягодник, липа, вяз, рябина, калина, аристолохия, клематис, жимолость, лиственница, ель, сосна обыкновенная, веймутова, туя, кипарисовик. А вот растений, которые перенесут постоянно повышенный уровень вод очень мало: дёрен даст слабый прирост, а метосеквойя потребует длительное время на перестройку, да и не наше это растение.

Тяжёлые глинистые почвы для Белоруссии не редкость. Можно полностью заменить почву на участке, провести дренажные работы, сделать нужный уклон для отвода воды и подсыпать песчаную подушку, но в данном случае, мы говорим о слое почвы 60см. от поверхности в глубину. Для однолетних и травянистых многолетних растений это решение вопроса, а вот для деревьев и высоких кустарников, у которых корневая система идёт в глубину на несколько метров — это помощь, но до тех пор, пока растение молодое. Поэтому, лучше избавить себя от разочарования в будущем и изучить список растений, пригодных именно для Ваших условий. Причём перечень растений довольно большой: клён, ольха, граб, дёрен, лещина, кизильник, боярышник, бересклет, бук, форзиция, ясень, плющ, падуб, дуб, смородина альпийская, шиповник, ежевика, ива, клематис. Из хвойных: кипарисовик, лиственница, микробиота, ель, псевдотсуга. Следует помнить, что некоторые сорта из вышеперечисленных растений могут быть очень прихотливыми, но тут важен индивидуальный подход. А видовые растения спокойно переносят данные условия.

Очень важный показатель – кислотность почвы . В прошлом мы уже говорили о том, что в Белоруссии преобладают кислые почвы, но для хвойных, рододендронов, гортензий и некоторых других растений нужен специальный субстрат. Его необходимо добавлять в посадочную яму и перемешивать с существующим грунтом. Рассмотрим многими любимую гортензию — о физиологическом происхождении смены цветов у этих растений. Как же получить голубые гортензии? Очень важно правильно выбрать сорт. Чистая голубая окраска возможна только у розовоцветного сорта, чьи цветы содержат достаточное количество красящего вещества дельфинидина. У белых цветов этого красящего вещества нет, поэтому они голубыми никогда не станут. Такие тёмно-розовые сорта, как «Гамбург», содержат небольшое количество дельфинидина в своих цветочных клетках. У них доминирует красный цвет, они дадут фиолетовый, что тоже может быть интересно. Только при достаточном внесении в почву алюминия до начала цветения гарантирует получение чистого голубого цвета. Алюминий можно вносить для растений в почву с низким значением pH, т.к. он в достаточной мере разлагается только при значении меньше 5.0 и может быть поглащён растениями. Сульфат алюминия вносят от 1,5 до 5 на м.куб. Гортензия нежного сорта «Букет роз» легко меняет цвет даже при слабокислой почве. Но, следует заметить, что растения с синими цветами гораздо ниже, чем с голубыми и розовыми. Смешанного цвета экземпляры могут быть самыми крупными.

Растения для кислых почв: Хвойные – пихта, кипарисовик, гинкго, можжевельник, ель, микробиота, сосна низкая или кедровый стланик, сосна веймутова, обыкновенная, Гриффита, псевдотсуга, тисс, туя, тсуга. Лиственные – ракитник, дабеция, дейция, лох, эрика, дрок, гортензия, падуб, ива, магнолия, пахисандра верхушечная, виды лапчаток, дуб болотный, красный, некоторый сорта смородины, малины, ежевики, роз, бузина красная, голубика. Рябина, калина, спирея, сирень, дёрен – выдерживают кислые почвы.

Если с влагой и кислотностью нам более-менее понятно, то «включить» солнечный свет в тенистых уголках и с северной стороны строений не получится. Но природа позаботилась и об этом. Если существуют такие условия, значит и растения для них найдутся. Хорошо чувствуют себя без яркого солнца зелёные сорта барбарисов, выносят тень: самшит, граб, дёрен, лещина, кизильник, боярышник, бересклет, бук лесной, голтерия, гамамелис виргинский, плющ, гортензия, падуб, керрия, бирючина, жимолость (цветение будет не обильным), некоторые сорта магнолии, пахисандра, пузыреплодник, пиерис японский (в нашей зоне зимует под укрытием), черёмуха, рододендрон, некоторые сорта крыжовника, шиповник, бузина, рябина, сорта калины, липа крупнолистная, бересклет форчуна, клематис, аристолохия. Из хвойных растений: пихта, виды и сорта елей, кипарисовиков, тсуга, микробиота, туя западная, складчатая, туевик долотовидный.

Необходимо отметить ещё один очень важный момент, на который обычно не обращают внимания – в природе встречаются ядовитые растения , и они широко используются в озеленении. Если в доме есть маленькие дети, то их внимание часто привлекают ягодки на декоративных растениях, они часто обрывают кору с веток или берут в рот части растений. У волчника ядовиты все части растения, а 10-12 ягод – смертельная доза для детей. У бересклета – ядовиты все части, 36 ягод – смертельны для взрослого человека. У падуба – ядовиты плоды и листья, 30 ягод – смертельны для взрослого. У бобовника — все части растения очень опасны, 4 боба – смертельная доза для ребёнка. У сумаха — опасны кора и млечный сок. У можжевельника – ядовиты все части растения, 20грамм – смертельны, особенно опасны концы побегов. Дурман, ландыш, наперстянку тоже относят к ядовитым растениям, но они не так опасны, как вышеперечисленные.

Аллергия – коварное заболевание и необходимо знать аллергены природного происхождения. Самая многочисленная группа аллергенов, проникающих в организм в основном из воздуха и при непосредственном контакте с кожей: пыльца растений (большая часть пыльцы выбрасывается растениями в утренние часы), споры плесневого гриба, мучнистая роса, сок некоторых растений, который выделяется при их повреждении. Отмечается два периода, когда в воздухе постоянно находится пыльца – это весна, когда цветут листопадные деревья и лето, время цветения трав. На этот период можно уехать. Не хочется создавать образ растений-врагов, каждое из нижеперечисленных обладает неповторимыми по красоте свойствами. Лиственные деревья: ива козья, ольха чёрная и серая, тополь, осина, лещина, береза, ясень, жасмин. Газонные травы нельзя доводить до цветения и скашивать вовремя. Злаки и разнотравье: овёс, рожь, пшеница, рис, пырей, тимофеевка, ежа, амброзия, мятлик луговой, плевел, ромашка, овсяница, подорожник, райграс, лисохвост, декоративные злаки, тысячелистник, астры, хризантемы, гелениум. Многие травы цветут во время цветения тополей и именно травы вызывают аллергические реакции, а тополя лишь являются источником пуха. Растения, вызывающие фитодерматозы: крапива, волчье лыко, одуванчик, марь белая, лебеда, полынь горькая, паслен, листья плюща, растения-первоцветы.

Практически в каждом саду можно встретить декоративные цветущие кустарники. У них множество достоинств. Во-первых, они очень красивые, во-вторых, многие из них достаточно морозостойкие, в-третьих, они бывают высокими и низкими (что расширяет возможности использования для разного вида ландшафтов). Но главное, что при правильном их подборе можно добиться постоянного цветения кустарников с первых весенних дней до поздней осени. Ценятся они не только за прекрасные, часто ароматные цветы, но и за декоративные листья, форму кроны и разнообразные плоды. Существует великое множество декоративных кустарников.

Большинство кустарников не теряют своей декоративности в течение всего теплого сезона, а некоторые остаются привлекательными даже зимой.

Есть кустарники, привлекающие своим ярким и обильным цветением, их можно назвать красивоцветущими. А есть такие, которые не могут похвастаться красивыми цветками, но у них листочки необычной окраски или формы. Такие кусты можно назвать декоративно-лиственными.

К первой группе можно отнести рододендроны, сирень, гортензию, бульденеж, спирею, боярышник, буддлею, бересклет и некоторые виды барбариса. А из второй группы можно назвать барбарис Тунберга, падуб, бирючину, скумпию кожевенную и другие.

Разделить на группы цветущие декоративные кустарники можно и по времени цветения. В апреле радуют нас форзиция, волчеягодник, дафна. Чуть позже к ним присоединяются хеномелес, миндаль низкий, кизильник, спирея, барбарис. В мае принимают эстафету калина, шиповник, сирень, чубушник. Лето дарит нам цветение роз, лапчаток, некоторых сортов спиреи. В июле покоряют своей красотой гортензии, которые украшают сады до самых холодов. Ранней осенью зацветают: вереск, кальмия. Ну а зимой украшением сада будет падуб остролистный и его хвойные собратья.

Осенние сады выглядят необыкновенно пестро и нарядно, благодаря некоторым листопадным видам кустарников. Когда уже ничего не цветет, барбарис, бересклет, арония, спирея, шиповник, скумпия и гибридные азалии своей листвой добавляют ярких красок самых разных оттенков осени. Большинство кустарников имеют плоды, которые также очень декоративны.

Различаются кустарники по росту, можно подобрать как карликовые — низкорослые, так и высокие сорта. По форме кроны бывают куполообразные, пряморастущие (пирамидальные), фонтанообразные, стелющиеся.

Кроме красоты и декоративности, следует подчеркнуть и практические свойства кустарников. Они достаточно быстро растут и являются долгожителями (до 5-8 лет без пересадки). Большинство из них неприхотливы к освещенности, составу почвы, достаточно морозоустойчивы. Не требуют постоянного ухода. Благодаря поверхностной корневой системе, могут расти на склонах, закрепляя сыпучий грунт.

Барбарис (Berberis) — листопадные или вечнозеленые колючие кустарники, семейство барбарисовых. Окраска листьев барбариса очень разнообразна, кроме обычной зеленой она бывает пестрой — с пятнышками или каймой, а также пурпурной или желтой. Различна и высота куста, зависит это от сорта. Диапазон от низкой — до 30 см, до высокой — более 3 м. Цветки у барбариса — маленькие желтые колокольчики. Зацветает в середине мая. Прекрасный медонос.

Не доставит много хлопот, ведь это очень неприхотливый кустарник. Любит свет, но хорошо растет и в тени. Совершенно нетребователен к почвам, не выносит только замокания. Не боится ветра и засухи. Морозоустойчив, особенно сорт — барбарис Тунберга (Berberis thunbergii), однако в первые три года на зиму необходимо небольшое укрытие. Если сорт барбариса вам неизвестен, то нужно сделать каркас из дуг и накрыть нетканым материалом в два слоя (так как некоторые пестролистные сорта могут быть менее морозоустойчивыми).

Низкорослые виды барбариса шикарно смотрятся на каменистых горках и в альпинариях. А высокорослые — как солитеры и в групповых посадках. Этот куст лидирует по использованию в живых изгородях и бордюрах как стриженных, так и свободных.

Бирючина обыкновенная (Ligustrum vulgare) — листопадный или вечнозеленый кустарник, семейство маслинные, высотой 2-3 метра. В июне-августе появляются симпатичные метельчатые соцветия с приятным ароматом, белые или кремовые. Их сменяют блестящие черные плоды. Листья кожистые, у большинства сортов темно-зеленые, но есть и декоративные формы с желтыми, голубовато-серебристыми листьями.

Бирючина — неприхотливое растение. Может расти на солнце и в полутени. Подходит любая почва (кроме глинистой с кислой реакцией). Засухоустойчиво, в очень жаркое время рекомендуется редкий, но обильный полив. Зимостойкое, легко восстанавливается, укрывать необходимо только некоторые сорта.

Особенность бирючины — она очень хорошо реагирует на стрижку и может долго сохранять форму. Поэтому замечательно подходит для плотных бордюров. Из нее получаются чудесные формованные изгороди. Можно создавать даже необычные живые стены. Выстриженные из бирючины топиарные фигуры являются прекрасным ландшафтным украшением.

Спирея (Spiraea) — листопадный кустарник с красиво изгибающимися ветками, семейство розоцветные. Это большой род кустарников, который подразделяется на весеннецветущие и летнецветущие. Цветы бывают разнообразными по форме соцветий и окраске (от белой до глубоко-малиновой). Высота его не превышает 2 м.

Растение очень неприхотливое. Хорошо адаптировано к городским условиям. Нормально растет в полутени, но предпочитает солнечные места. Почва подойдет любая, но лучше слабокислая. Полив умеренный. Растет быстро, зацветает на третий год. Морозоустойчива.

Приобрела заслуженную любовь у садоводов и ландшафтных дизайнеров. Большущее разнообразие ее сортов предоставляет много возможностей для творчества. Форма куста может быть пирамидальной, шарообразной, струящейся. Окрас листьев меняется от зеленого до желтого, оранжевого или пурпурно-красного. Многочисленные маленькие цветочки собраны в разнообразнейшие по форме соцветия. Все эти особенности кроны, листьев и цветков позволяют создавать чудесные композиции. А если правильно подобрать сорта, то можно любоваться непрерывным цветением спиреи в течение всего теплого сезона. Используется в рокариях, живых изгородях, как обрамление для зеленолистных групп деревьев.

Бобовник (Laburnum) — семейство бобовые, имеет 6 видов кустарников, ценятся за красивое цветение. Самые распространенные — Бобовник анагиролистный или «Золотой дождь» (Laburnum anagyroides) и Бобовник альпийский (Laburnum alpinum). «Золотой дождь» — кустарник с гладкой зеленой, а позже светло-коричневой корой. Может иметь как пирамидальную, так и куполообразную поникающую форму кроны. Листья тройчатые, состоят из овальных листиков, нижняя сторона которых опушена. В конце лета они становятся светло-желтого цвета. Цветет в мае. Соцветия в виде большой свисающей кисти (до 30 см), состоящей из желтых цветков с мотыльковыми венчиками. Имеют слабый аромат. Плоды сначала бывают опушенные, потом становятся гладкими. Бобовник альпийский очень похож на «Золотой дождь», хотя более морозоустойчив. Ветви и листья у него меньше, плоды не опушены.

Растение ядовито! Плоды содержат алкалоиды – лабурнин и цитизин. Нельзя допускать к нему детей.

Бобовник светолюбив. К почвам нетребователен, но обязателен хороший дренаж. Бобовнику требуется постоянная обрезка, чтобы избежать превращения кустарника в большое (до 7 м) дерево. Пока деревья молодые, они нуждаются в опоре. Первые три года молодые растения следует мульчировать и укрывать агроволокном. После небольшого подмерзания крона быстро восстанавливается.

Как в групповой, так и в одиночной посадке смотрится очень ярко и красиво, благодаря большому количеству огромных цветочных кистей. Из бобовника получаются восхитительные навесы и перголы.

Рододендрон (Rhododendron) — листопадный или вечнозеленый кустарник, семейство вересковых. В природе произрастает в Западной Сибири, Дальнем Востоке, Монголии и Китае. Существует множество сортов с разнообразной листвой: копьевидной, круглой, овальной. Соцветия щитковидные. Форма цветков и их окраска также очень разнообразны, по своей красоте может поспорить даже с розами. Цветут с конца апреля и практически все лето. Их стали понемногу выращивать в садах, однако нужно внимательно подбирать морозоустойчивые сорта, способные перезимовать в нашем климате.

Участок для посадки рододендронов должен быть защищен от ветра и находиться в полутени. Почва подойдет кислая или нейтральная. Нужен регулярный полив.

В наших краях они не достигают больших размеров. Подобрав различные сорта рододендронов, можно обеспечить их постоянное цветение весь сезон. Очень красиво смотрятся рядом с хвойными растениями. Их низкорослые сорта отлично подходят для альпинариев. Применяют рододендроны для создания вблизи водоемов живых изгородей.

Ирга (Amelanchier) – листопадный кустарник или небольшое деревце, семейство розоцветных. Весной, часто опережая листья, на ирге расцветают красивые белые цветки. Цветение недолгое, после появляются маленькие черно-фиолетовые плоды округлой формы (похожие на малюсенькие яблочки).

Плоды вкусные, сочные, богатые витаминами (особенно Р). Зеленые листья ирги осенью вспыхивают яркими красками: желтыми, алыми.

Ирга очень неприхотливое растение. Светолюбиво, но переносит и затенение. Не любит переувлажнения. Очень зимостойкое. Не боится ни холодного ветра, ни весенних заморозков. Некоторые виды этого декоративного кустарника пригодны даже для украшения сада в условиях Сибири и Крайнего Севера.

Это далеко не полный список морозостойких декоративных кустарников.

Любители тени

Многие декоративные кустарники могут нормально расти и развиваться в умеренно затененных местах. Правда, это может сказаться на обильности цветения. Некоторые же отлично переносят затенение, более того, им противопоказаны прямые солнечные лучи.

Кизил (Cornus) – листопадный сильноветвистый кустарник, семейство кизиловых. Весной кизил украшает сад своим цветением. Мелкие белые, пурпурные или желтые цветки кизила собраны в головку или зонтик (зависит от вида). Есть сорта, у которых мелкие цветки в соцветиях неприглядны, но окружены большими яркими лепесткообразными листиками (брактеями).

Осенью листва кизила тоже радует глаз ярко-желтыми, оранжевыми и багряными красками. Также осенью созревают и плоды. Чаще всего темно-красные, иногда светло-желтые или розовые, продолговатой формы. Они не только добавляют кусту декоративности, но и являются вкусными и полезными.

Листья кизила на открытом солнце легко получают ожоги, поэтому для него подходят затененные участки. Предпочитает влажные грунт и воздух. К составу почвы нетребователен. Большинство сортов морозоустойчивы, но некоторые требуют небольшого укрытия на зиму. Отличается кизил и долговечностью. В ландшафтном дизайне кусты кизила используются как солитер или в миксбордерах.

Гортензия (Hydrangea) — семейство гортензиевые, листопадный декоративный кустарник. Цветки собраны в крупные куполообразные или метельчатые соцветия. Чаще всего бывают белыми, но встречаются голубые, красные и розовые. Цвет некоторых растений может меняться от химического состава почвы. В
зависимости от сорта, высота кустов колеблется от 1 до 3 метров. Есть и карликовые сорта.
Растение влаголюбивое, сажать лучше в полутень. Многие сорта метельчатой и древовидной гортензии морозоустойчивы. Однако необходима защита в зиму: пришпиливание веток к земле, с последующим лапником и агроволокном. Подмерзшие ветки весной обрезают и растение быстро отрастает.

В ландшафтном дизайне используется как одиночно, так и в композициях с хвойными или другими декоративными кустарниками, а также луковичными цветами. Кусты изумительно смотрятся за счет пышности соцветий и их большого количества.

Падуб (Ilex aquifolium) или остролист — вечнозеленый или листопадный кустарник, семейство падубовые. В дикой природе произрастает почти повсюду. Это красивое растение с темно-зелеными или двуцветными кожистыми листьями. Цветение длится всего две недели с мая по июль (в зависимости от сорта). Цветочки маленькие, белые и душистые. Особенно декоративен с наступлением зимы, когда на смену скромным цветкам приходят яркие соплодия из бусинок-ягод. Падуб — обязательный компонент западных рождественских венков.

Было выведено много сортов падуба. Некоторые с белой или желтой каймой по краям листьев, или с оттенком синевы. Сугубо мужской сорт Blue Prince является прекрасным опылителем. Следует заметить, что падуб растение двудомное и женские сорта радуют нас красными ягодами, только если вблизи растет мужской экземпляр.

Открытые солнцу участки падубу противопоказаны, так как он может пострадать от солнечных ожогов. Высаживать его нужно в тенистое место с лесной почвой. Не переносит засуху, необходимо регулярное увлажнение. Большинство сортов морозостойкие.

Благодаря густой и колючей листве падуб хорошо использовать как живую изгородь. Это медленнорастущий куст, хорошо реагирующий на стрижку, вот поэтому из него получаются замечательные топиарии. Красивые листья падуба летом становятся отличным фоном для луковичных или других многолетних цветов. Вечнозеленая листва и красные ягоды зимой делают падуб ярким акцентом в опустевшем саду.

Хвойные кустарники

Есть еще вид декоративных кустарников, у которых нет ни красивых листьев, ни цветов, но от этого они не менее привлекательны. Это хвойные кустарники.

Можжевельник (Juniperus) — вечнозеленый кустарник семейства кипарисовых. Хвоя игловидная или чешуйчатая. Плоды сине-черные шишкоягоды (иногда красно-бурые). Растение двудомное. Существует
множество видов можжевельника. Есть среди них и высокие кусты (более двух метров), есть совсем карликовые (до 30 см). Также представлены они и разнообразием форм: стелющиеся, пирамидальные, куполообразные. Много морозоустойчивых сортов.

Можжевельники хорошо растут на светлых солнечных участках. Малотребовательны к почвам. Засухоустойчивы. В засушливое лето требуется несколько раз хорошо их полить. Даже морозоустойчивые сорта в первый год после посадки требуют зимнего укрытия. Можжевельники с пирамидальной кроной на зиму необходимо обвязывать, чтобы под тяжестью снега не ломались ветки.

Низкорослые и стелющиеся сорта можжевельника используют в альпийских горках и для закрепления откосов и склонов. Также из них можно создавать очень оригинальные бордюры. Высокие сорта используют в одиночных и небольших групповых посадках.

Туя (Thuja) – вечнозеленые деревья и кустарники, семейство кипарисовые. Листья чешуевидные. Плоды — продолговатые или овальные шишечки с несколькими парами чешуй. Семена плоские с двумя крылышками. Это растение однодомное. Имеет много декоративных искусственно выведенных форм.

Растет на солнечных участках и в полутени. Почва подходит любая, но хорошо проницаемая. Нужен регулярный полив и мульчирование прикорневой зоны. Туи морозостойкие, но молодые растения в первые два-три года требуют укрытия на зиму. Как и у можжевельников, высокие пирамидальные сорта туи на зиму необходимо связывать, чтобы избежать повреждения веток под тяжестью снега.

Благодаря своей долговечности, зимостойкости и приспособленности к городским условиям, тую очень широко применяют в декоративном садоводстве во многих климатических зонах.

В ландшафтном дизайне используется для создания живописных аллей. Из плотно посаженных групп, в зависимости от высоты куста, формируются живые стены или изгороди. Так же хорошо туя смотрится и как солитер.

Декоративные кустарники, в большинстве своем, отличаются неприхотливостью в уходе, хорошо переносят зимние морозы и в то же время необыкновенно красивы. Каждый может подобрать себе подходящие именно для его сада сорта и виды. Их разнообразие позволяет сделать сад ярким, цветущим и восхитительным практически круглый год!

Стержневая корневая система — корневая система, у которой хорошо развит главный корень по сравнению с боковыми корнями. Главный корень имеет форму стержня, отсю

Пользователи также искали:

стержневая корневая система имеет, стержневая корневая система примеры, стержневая корневая система состоит из, стержневая корневая система у двудольных, стержневая корневая система у каких растений, стержневая корневая система у однодольных или двудольных, стержневая корневая система у однодольных, корневая, стержневая, система, Стержневая, Стержневая корневая система, однодольных, двудольных, растений, состоит, примеры, характерна, каких, имеет, стержневая корневая система у однодольных, стержневая корневая система у каких растений, стержневая корневая система имеет, стержневая корневая система у двудольных, стержневая корневая система состоит из, стержневая корневая система у однодольных или двудольных, стержневая корневая система характерна для, стержневая корневая система примеры, стержневая корневая система, корень. стержневая корневая система,

Тема 4. Органы цветковых растений.

20. Дадим определение понятию.
Орган – это часть тела, выполняющая определённые функции.

21. Подпишем названия органов цветка, обозначенных на рисунке цифрами.

22. Заполним таблицу.

23. Схематически изобразим стержневую и мочковатую корневую систему.

24. Приведем примеры растений со стержневой и мочковатой корневой системой.
а) стержневая корневая система – люпин, фасоль, одуванчик
б) мочковатая корневая система – рис, пшеница, лук.

25. Подпишем виды корней, обозначенные на рисунке цифрами.

26. Заполним таблицу.

27. Заполним таблицу по видоизменениям корней.

28. Подпишем части побега, обозначенные на рисунке цифрами.

29. Подпишем части стебля, обозначенные на рисунке цифрами.

1 – сердцевина
2 – древесина
3 – камбий
4 – кора
5 – пробка

30. Заполним таблицу.

31. Дадим определение понятию.
Почка – это зачаточный побег.

32. Подпишем структуры листовой и цветочной почки.

33. Подпишем части листа. Укажем его тип.  

34. Обозначим части внутреннего строения листа.

35. Дополним предложения.
В листе происходят сложные процессы дыхания, образования питательных веществ, испарения воды.
У некоторых растений листья видоизменяются и выполняют несвойственные им функции: колючки кактуса – защитную, усики гороха – опорную.

36. Поделим листья на простые и сложные, обозначенные на рисунках цифрами.

 Простые листья: 1, 2, 4, 6, 7, 8.
Сложные листья: 3, 5, 9, 10.

37. Подпишем части цветка, обозначенные на рисунке цифрами.

 38. Раскрасим каждую часть цветка одним цветом.

39. Схематически изобразим строения обоеполого и раздельнополого цветков.

40. Дадим определение понятию.
Соцветие – это группа соцветий.

41. Напишем биологическое значение соцветий.
Соцветия необходимы растениям для привлечения насекомых. Это повышает вероятность опыления насекомыми.

42. Заполним таблицу.

 43. Заполним схему.

44. Подпишем части зерновки кукурузы и семени фасоли, обозначенные на рисунках цифрами.

45. Напишем примеры двудольных и однодольных растений.
Однодольные: лук, ирис, пшеница, пальмы, камыш, осока, орхидеи.
Двудольные: помидоры, дуб, яблоня.

46. Заполним схему.

 

Лабораторная работа
«Строение семян»

 1. Схематически изобразим, как выглядит семя фасоли.

 2. Напишем значение семенной кожуры для семени.
Семенная кожура защищает семя и зародыш от неблагоприятных условий для развития.

3. Зарисуем зародыш семени и подпишем его основные части.

 4. Зарисуем зерновку пшеницы и подпишем ее основные части.

5. Препаровальной иглой попытайтесь снять покров зерновки.

6. Зарисуем зерновку пшеницы и подпишем ее основные части.

7. Обозначим отличительные и общие черты в строение семени фасоли и зерновки пшеницы.


Виды корней. Типы корневых систем. Зоны корня. Биология. 6 класс. Конспект урока

ЭТАПЫ УРОКА

СОДЕРЖАНИЕ ЭТАПОВ

ДЕЯТЕЛЬНОСТЬ
учащихся

ФАЗЫ РАБОТЫ ПАМЯТИ

ОРГМОМЕНТ

  1. Учитель приветствует учащихся, интересуется состоянием их здоровья и психологическим настроем учащихся на урок.
  2. Учитель разъясняет цели и задачи урока, предлагает структуру урока.

Внимательно слушают, отвечают на вопросы, задают вопросы.

 

МОТИВАЦИЯ УЧАЩИХСЯ (ИНДУКЦИЯ).

  1. Что вы знаете о корне растения?
  2. Для чего нужен корень растению?
  3. У всех ли растений есть корень?
  4. Для чего нам нужны знания о корне?

Отвечают на вопросы учителя.

 

ПРОВЕРКА ДОМАШНЕГО ЗАДАНИЯ.

1. ГРАФИЧЕСКИЙ ДИКТАНТ ПО ТЕМЕ «СЕМЯ»

  1. Семена образуются у всех растений на Земле.
  2. Семена созревают в плодах.
  3. Морковь – это однодольное растение, а чеснок – двудольное растение.
  4. Семена однодольных и двудольных растений содержат зародыш.
  5. Зародыш семени однодольных растений состоит из одной семядоли, корешка, стебелька и почечки.
  6. Эндосперм содержится в семенах двудольных растений.
  7. Эндосперм содержит запас питательных  веществ.
  8. В семенах пшеницы из запасных питательных веществ преобладает крахмал.
  9. В семенах подсолнечника преобладает растительное масло.
  10. В зародыше и кожуре зерен пшеницы, риса, кукурузы необходимое для здоровья вещество: витамин В1.

КЛЮЧ К ДИКТАНТУ:
—  +  —   +   +   —   +   +   +   +
——————————-
1 2   3  4   5   6   7   8   9   10

Работают в тетради.

Затем обмениваются тетрадями и по ключу, выданному учителем, осуществляют взаимопроверку, выставляют отметку в тетради.

Формирование долговременной памяти по теме «Семя».

2. Учащимся предлагается в конвертах 2 разрезанные схемы: «Строение семени фасоли» и «Строение зерновки пшеницы». За три минуты они должны правильно их собрать.

Работают в парах. По мере выполнения задания осуществляют взаимопроверку, исправляют ошибки.

 

ИЗУЧЕНИЕ НОВОЙ ТЕМЫ.

План изучения темы:

1) функции корня;

2) виды корней;

3) типы корневых систем;

4) клеточное строение молодого корня: зоны корня; ткани

 

 

1.ФУНКЦИИ КОРНЯ.


Слушают объяснение учителя и фиксируют схему в тетрадь

Аудиально-визуально-кинестетическое восприятие.

Концентрация внимания.

Запечатление

2. ВИДЫ КОРНЕЙ.

Учитель рассказывает детям о том, что корни различаются по внешнему строению и расположению относительно друг друга и других органов растения. Выделяют три вида корней: главные, боковые и придаточные.

Главный корень бывает у растения один, значительно длиннее и толще других. Отходит от стебля (схема 1.)

Придаточные корни отходят от стебля и других органов, их много. Они имеют приблизительно одинаковые размеры (схема 1).

Боковые корни возникают как ответвления от главных, придаточных и других боковых корней.

Внимательно слушают объяснение учителя.

Аудиальное
восприятие.

СХЕМА 1 «ВИДЫ КОРНЕЙ И ТИПЫ КОРНЕВЫХ СИСТЕМ».


Копируют схему в рабочие тетради.

Задают уточняющие вопросы учителю

Визуально-кинестетическое восприятие.

Концентрация внимания.

Запечатление

3. ТИПЫ КОРНЕВЫХ СИСТЕМ.

Используя схему 1, учитель объясняет, что совокупность корней растения называют корневой системой.


СКС характерна для двудольных растений  (морковь, петрушка, дуб, сосна).

МКС характерна для однодольных растений (рожь, пшеница, овес).

 

Слушают учителя, рассматривают схемы, за-
дают вопросы учителю.

Аудиально-визуально-эмоциональное
восприятие.

Концентрация
внимания.

Запечатление.

4. КЛЕТОЧНОЕ СТРОЕНИЕ МОЛОДОГО КОРНЯ: ЗОНЫ КОРНЯ.

Что общего между сердцем и корнем в специфике их работы? Это ее непрерывность (безостановочность).

Корни растут непрерывно, если условия благоприятны. Это врожденное свойство, но оно возникло и развилось от необходимости следовать в почве за водой и питательными веществами. В постоянном росте корней состоит стратегия выживания неподвижного растения. Поэтому растущий корень делится на зоны: деления, роста, всасывания, проведения. Учитель характеризует каждую зону, используя таблицу «Строение корня». В заключение подтемы учитель демонстрирует учащимся таблицу «Зоны корня» (на ватмане) и предлагает учащимся зафиксировать ее в своих тетрадях.

Внимательно слушают учителя.

Аудиальное восприятие.

Концентрация.

Таблица 2. ЗОНЫ КОРНЯ.

ЗОНА

ОСОБЕННОСТИ КЛЕТОК

ФУНКЦИЯ

ДЕЛЕ-
НИЯ

Клетки мелкие, тонкостенные, одинаковы по размеру

Непрерывное деление клеток, увеличение общего их числа.

РАСТЯ-
ЖЕНИЯ
(РОСТА)

Клетки удлиненные.

Здесь клетки удлиняются, достигая своего нормального размера.

ВСАСЫВАНИЯ
(КОРНЕВЫХ
ВОЛОСКОВ)

Клетки – корневые волоски.
Имеют вытянутую форму, что увеличивает площадь всасывающей поверхности

Всасывание воды с минеральными веществами.

ПРОВЕДЕНИЯ

Клетки первичной коры и центрального цилиндра.

Проведение воды с минеральными веществами из корня в стебель, а органических веществ из стебля в корень.

СТРОЕНИЕ КОРНЕВОГО ВОЛОСКА.


Такая форма клетки позволяет увеличить площадь всасывающей поверхности, улучшая тем самым минеральное питание растения.

Слушают учителя, рассматривают таблицу.

Фиксируют таблицу в тетрадях.

Аудиально-визуальное восприятие.

Концентрация внимания.

Кинестетическое восприятие.

Запечатление.

Забывание подтемы «Виды корней и типы корневых систем».

 

ЗАКРЕПЛЕНИЕ ИЗУЧЕННОГО МАТЕРИАЛА.

ЗАДАНИЕ 1. Работа в парах. Каждая пара получает в конвертах разрезанную схему (мозаику) «Виды корней и типы корневых систем». Учащимся предлагается собрать ее в течение 5 минут. Провести взаимопроверку.

Собирают схемы. Корректируют ошибки друг друга.  Проводят анализ и делают вывод о видах корней и типах корневых систем.

Первичное повторение.

Припоминание.

Концентрация внимания.

Запечатление.

Забывание подтемы «Зоны корня».

ЗАДАНИЕ 2. Работа с тестом (лучше устно). Тест выдается каждому учащемуся.

Задание теста: из предложенных утверждений выбрать только правильные.

  1. Существует четыре вида корней: главные, боковые, придаточные, стержневые.
  2. Типов корневых систем бывает только две : стержневая и мочковатая.
  3. В стержневой корневой системе бывает два и более главных корней и множества боковых.
  4. Мочковатая корневая система представлена множеством придаточных и боковых корней.
  5. Главный корень всегда отходит от стебля.
  6. Боковые корни отходят от главных, придаточных и боковых корней.
  7. Придаточные корни отходят от стебля или других органов.
  8. Мочковатая корневая система характерна для двудольных растений.
  9. Выделяют 5 зон корня: деления, роста, всасывания, проведения, развития.
  10. Зона деления расположена перед зоной роста.
  11. Зона всасывания располагается за зоной растяжения.
  12. Зона всасывания – это зона корневых волосков.
  13. Корневой волосок – это одна сильно вытянутая клетка, имеющая все компоненты растительной клетки.
  14. Корневой чехлик прикрывает зону деления.
  15. Всасывание питательных веществ происходит в зоне проведения.
  16. Если бы корневые волоски походили на обычные клетки, то количество всасываемых питательных веществ не изменилось.
  17. В пустыне встречаются растения с наиболее длинными корнями.
  18. Корни растений могут проникать на глубину до 30 м (пустынная акация, тамариск).

Отвечают устно.

Корректируют и анализируют ответы друг друга.

Могут задавать уточняющие вопросы.

Припоминание.

Концентрация.

Запечатление.

ЗАДАНИЕ 3. Каждому ученику выдается карточка- немая схема с изображением зон корня, на которой они должны правильно подписать каждую  и указать кратко функцию данной зоны. Задание выполняется в течение 4-5 минут. После выполнения задания учитель выборочно просит одного (или нескольких) ученика прокомментировать свои ответы. В это время все остальные проверяют правильность выполнения своих заданий.

Работают индивидуально.

Внимательно слушают ответ одноклассника. Анализируют его и свой ответ. Исправляют ошибки.

Устанавливают истину.

Припоминание.

Концентрация.

Запечатление.

ДОМАШНЕЕ ЗАДАНИЕ.

  1. Биология: под ред. В.К.Шумного и др. параграфы 11 и 12, задания 1-6.
  2. Опорные конспекты в рабочих тетрадях.
  3. Индивидуальные задания: 1)сообщение «Зависимость строения и развития корневой системы от условий жизни растения» готовит Старостина Ирина; 2)графический диктант по теме «Виды корней. Типы корневых систем. Зоны корня» готовит Архипов Валерий. 3)написать благодарственное письмо корню от имени цветка.

Записывают задания в дневник и тетради.

 

РЕФЛЕКСИВНЫЙ ЭТАП.

  1. Выставление отметок за урок.
  2. Значимость данной темы в вашей жизни.
  3. Какие моменты были самыми трудными для восприятия? В какой момент урока все таки «трудное стало доступным»? (учитель тем самым выясняет насколько способы изучения данной темы, предложенные им, соответствуют способам восприятия учащихся).
  4. Учащиеся дают оценку уроку.

Беседуют с учителем.

Отвечают на вопросы учителя и друг друга.

Обмениваются мнениями, дают советы и пожелания друг другу и учителю по оптимизации форм, средств и методов при изучении этой темы.

 

Слово СТЕРЖНЕВОЙ — Что такое СТЕРЖНЕВОЙ?

Слово состоит из 10 букв: первая с, вторая т, третья е, четвёртая р, пятая ж, шестая н, седьмая е, восьмая в, девятая о, последняя й,

Слово стержневой английскими буквами(транслитом) — sterzhnevoi

Значения слова стержневой. Что такое стержневой?

Стержневой ящик

Стержневой ящик, ящик, в котором изготовляются литейные стержни, образующие отверстия и полости в отливке. По конструкции С. я. делятся на неразъёмные (вытряхные) и разъёмные. Выбор типа С. я. зависит от формы и размеров стержня…

БСЭ. — 1969—1978

Стержневая лампа

Стержневая лампа, сверхминиатюрная приёмно-усилительная лампа с катодом прямого подогрева, в которой электроды, управляющие электронным потоком (сетки), выполнены в виде стержней (обычно круглого или прямоугольного сечения).

БСЭ. — 1969—1978

СТЕРЖНЕВАЯ ЛАМПА — сверхминиатюрная лампа, в к-рой управление электронным потоком осуществляется стержнями круглого или прямоугольного сечения, расположенными параллельно прямолинейному катоду прямого накала.

Большой энциклопедический политехнический словарь

СТЕРЖНЕВАЯ ЛАМПА — сверхминиатюрная приемно-усилительная лампа с катодом прямого подогрева, в которой управляющие электронным потоком электроды (сетки) выполнены в виде стержней.

Большой энциклопедический словарь

Стержневые смеси

Стержневые смеси, составы из кварцевого песка или др. огнеупорных наполнителей, связующих и катализаторов, предназначенные для изготовления литейных стержней и некоторых элементов форм (литниковых чаш, фильтровальных сеток и др.).

БСЭ. — 1969—1978

СТЕРЖНЕВЫЕ СМЕСИ — огнеупорные газопроницаемые и гигроскопичные смеси для изготовления литейных стержней. Различают С. с. песчано-глинистые и из кварцевого песка и литейных крепителей, а также песчано-смоляные, жидкие самотвердеющие смеси.

Большой энциклопедический политехнический словарь

СТЕРЖНЕВАЯ МАШИНА

СТЕРЖНЕВАЯ МАШИНА — машина для изготовления литейных стержней. Рабочий процесс С. м. состоит в уплотнении стержневой смеси в стержневых ящиках и удалении из них заформованных стержней.

Большой энциклопедический политехнический словарь

Стержневой корень

Стержневой корень главная основная часть корневой системы многих растений, являющаяся непосредственным продолжением в земле стебля и развивающаяся из первоначального корешка зародыша семени.

Энциклопедический словарь Ф.А. Брокгауза и И.А. Ефрона. — 1890-1907

СТЕРЖНЕВОЙ КОРЕНЬ, первый КОРЕНЬ растения, который развивается из ПЕРВИЧНОГО КОРЕШКА. Стержневой корень растет прямо вниз и остается главным корнем растения, распуская боковые корни для расширения распространения корневой системы.

Научно-технический энциклопедический словарь

Стержневой корень — Корневая система, в которой первичный корень имеет значительно больший диаметр, чем любой из боковых корней (например, корневая система моркови).

Заид А. Словарь терминов по биотехнологии

Стержневая система

Стержневая система в строительной механике, несущая конструкция, состоящая из прямолинейных или криволинейных стержней, соединённых между собой в узлах.

БСЭ. — 1969—1978

СТЕРЖНЕВАЯ СИСТЕМА — в строительной механике — несущая конструкция, состоящая из стержней, жёстко или шарнирно соединённых между собой в узлах. Различают плоские и пространств. С. с. Примеры С. с.: ферма, рама. Система из двух стержней ОА и АВ…

Большой энциклопедический политехнический словарь

СТЕРЖНЕВАЯ СИСТЕМА (в строительной механике) — несущая конструкция, состоящая из стержней, жестко или шарнирно соединенных между собой в узлах. Различают плоские и пространственные стержневые системы.

Большой энциклопедический словарь

Стержневая мельница

Мельницы стержневые — измельчительное устройство, применяемое для грубого помола (до 500—1000 мм) обогащаемого сырья перед окончательным помолом в шаровых мельницах. диаметр барабана — от 900 мм длина барабана — от 1860 мм объём барабана — от 0…

ru.wikipedia.org

Стержневая радиолампа

Стержневая радиолампа — электронная лампа с электродами, выполненными в виде системы тонких сплошных стержней, расположенных параллельно. Стержневые лампы выгодно отличаются от традиционных (с витыми сетками) лучшей экономичностью…

ru.wikipedia.org

Стержневое оборудование

Стержневое оборудование, устройства для механизированного изготовления литейных стержней путём заполнения стержневого ящика стержневой смесью и её уплотнения.

БСЭ. — 1969—1978

Русский язык

Стержн/ев/о́й.

Морфемно-орфографический словарь. — 2002

Примеры употребления слова стержневой

Странным, неудобным, но с потрясающей внутренней стержневой структурой.

Никита Михалков, снявшийся у Балабанова в криминальной драме «Жмурки», назвал его странным и неудобным, но с удивительной внутренней стержневой структурой человеком.

Никита Михалков, снявшийся у А.Балабанова в криминальной драме «Жмурки», назвал его странным, неудобным, но с потрясающей внутренней стержневой структурой человеком.


  1. стерженщик
  2. стерженщица
  3. стержень
  4. стержневой
  5. стерилизатор
  6. стерилизационный
  7. стерилизация

шток | Описание, факты и типы

Стебель , в ботанике — ось растения, несущая почки и побеги с листьями и корнями у основания. Стебель проводит воду, минералы и пищу к другим частям растения; он также может хранить пищу, а сами зеленые стебли производят пищу. У большинства растений стебель является основным вертикальным побегом, у некоторых он незаметен, у других он видоизменен и напоминает другие части растения (например, подземные стебли могут выглядеть как корни).

стебель

Листья, стебель и корневая система саженца фигового дерева ( Фикус ).

© Беата Бекла / Shutterstock.com

Подробнее по этой теме

покрытосеменных: Стебли

Стебель — это воздушная ось растения, которое несет листья и цветы и проводит воду и минералы от корней и пищи с участка …

Основные функции стебля — поддерживать листья; проводить воду и минералы к листьям, где они могут быть преобразованы в полезные продукты путем фотосинтеза; и транспортировать эти продукты от листьев к другим частям растения, включая корни.Стебель проводит воду и питательные минералы от места их впитывания в корнях к листьям через определенные сосудистые ткани ксилемы. Перемещение синтезированной пищи от листьев к другим органам растения происходит в основном через другие сосудистые ткани стебля, называемые флоэмой. Еда и вода также часто хранятся в стебле. Примеры стеблей, хранящих пищу, включают такие специализированные формы, как клубни, корневища и клубнелуковицы, а также древесные стебли деревьев и кустарников. В стеблях кактусов в значительной степени развиты запасы воды, и все зеленые стебли способны к фотосинтезу.

Кактус шар

Кактус шар ( Parodia magnifica ).

© Stephan von Mikusch / Fotolia

Рост и анатомия

Первый зачаток молодого стебля или побега зародышевого растения появляется из семени после того, как корень впервые вырастет. Растущая часть на верхушке побега — это конечная почка растения, и благодаря продолжающемуся развитию этой почки и прилегающих к ней тканей стебель увеличивается в высоту. Боковые почки и листья вырастают из стебля через промежутки, называемые узлами; промежутки на стебле между узлами называются междоузлиями.Количество листьев, которые появляются на узле, зависит от вида растения; один лист на узел является обычным явлением, но у некоторых видов на узлах могут расти два или более листа. Когда лист опадает со стебля в конце вегетационного периода, он оставляет шрам на стебле из-за разрыва сосудистых (проводящих) пучков, которые соединяли стебель и лист. По мере того, как стебель продолжает расти, образуются боковые почки, которые развиваются в боковые побеги, более или менее напоминающие родительский стебель, и они в конечном итоге определяют ветвление растения.У деревьев боковые побеги развиваются в ветви, из которых возникают другие боковые побеги, называемые веточками или веточками. Точка, в которой лист отклоняется по оси от стебля, называется пазухой. Бутон, образовавшийся в пазухе ранее сформированного листа, называется пазушной почкой, и он, как и листья, образуется из тканей стебля. Во время развития таких почек внутри них образуются сосудистые пучки, которые являются продолжением пучков на стебле.

анатомия ствола

Продольный разрез (слева) и поперечный разрез (справа) растущего стебля показывают организацию различных тканей для более молодой (вверху) и более старой (внизу) частей ствола.

Encyclopædia Britannica, Inc.

В стеблях молодых двудольных (покрытосеменных с двумя семенными листами) и голосеменных сосудистые пучки (ксилема и флоэма) расположены по кругу вокруг центрального ядра губчатой ​​наземной ткани, называемого сердцевиной. Сосудистые пучки окружают слой, толщина которого у разных видов различается, и он называется корой. Вокруг него и составляет внешнюю поверхность стебля слой, называемый эпидермисом. У растений с древесными стеблями к этим первичным тканям добавляются различные вторичные ткани.Среди наиболее важных из них — кольцо меристематических клеток, которые, в свою очередь, дают начало сосудистому камбию. Эта ткань возникает между первичной ксилемой и флоэмой и дает начало вторичной флоэме снаружи и вторичной ксилеме внутри; последняя ткань — это древесина деревьев.

поперечное сечение ножки

Светлая микрофотография поперечного сечения ножки Tilia . В центре находится сердцевина, окруженная слоем дерева (ксилема). Тонкий камбий отделяет его от флоэмы.Внешний слой клеток колленхимы окружен внешней корой.

© Стив Гшмайсснер — Библиотека научных фотографий / Getty Images Получите подписку Britannica Premium и получите доступ к эксклюзивному контенту. Подпишитесь сейчас

Типы и модификации стеблей

Многие растения являются однолетними и завершают свой жизненный цикл за один вегетационный период, после чего все растение, включая стебель, погибает. У двулетних растений нижняя часть стебля, часто модифицированная для хранения пищи, сохраняется после первого вегетационного периода и дает почки, из которых возникает прямостоячий стебель во время второго вегетационного периода.У многолетних растений короткий стебель может давать новые побеги в течение многих лет. Растения, дающие древесные стебли, называются деревьями и кустарниками; последние производят ветви из земли или вблизи земли, тогда как первые имеют заметные стволы.

Дерево Джошуа

Деревья Джошуа ( Yucca brevifolia ) в Национальном парке Джошуа-Три, Калифорния, США

AdstockRF

В целом, стебель имеет прямостоячий или восходящий вид, но может лежать ниц на земле, так как в сладком картофеле и клубнике.Стебель может взбираться на камни или растения с помощью корешков, как у плюща; у других лоз есть вьющиеся стебли, которые спирально обвиваются вокруг опорного растения, как у жимолости и хмеля. В других случаях вьющиеся растения поддерживаются усиками, которые могут быть специализированными стеблями, как у винограда и пассифлоры. В тропическом климате вьющиеся растения часто образуют толстые древесные стебли и называются лианами, тогда как в регионах с умеренным климатом они обычно представляют собой травянистые лозы. Столон — это стебель, который изгибается к земле и, достигнув влажного места, укореняется и образует прямой стебель и, в конечном итоге, отдельное растение.Среди подземных стеблей есть корневище, клубнелуковица и клубень. У некоторых растений стебель не удлиняется во время раннего развития, а вместо этого образует короткую коническую структуру, из которой возникает крона из листьев. Они могут образовывать луковицу (как у лука и лилии), кочан (капуста, салат) или розетку (одуванчик, подорожник).

Редакторы Британской энциклопедии. Последняя редакция и обновление этой статьи выполняла Мелисса Петруццелло, помощник редактора.

Узнайте больше в этих связанных статьях Britannica:

растений вокруг нас — Science World

Цели

  • Укажите несколько примеров местных растений и способы их использования.

  • Повышают свои навыки наблюдения за природными объектами.

  • Опишите, как дерево растет с годами.

  • Изучение различных аспектов жизненного цикла растений.

Материалы

Фон

Важность наблюдения

Способность смотреть на растения вокруг вас, изучать их и критически оценивать то, как они растут, воспроизводятся и адаптируются к окружающей среде с течением времени, — очень важные научные навыки.Многие из величайших ученых на протяжении всей истории пришли к своим теориям, просто наблюдая за растениями вокруг них.

Четыре исторически важных ботаника: Карл Линней, Мария Сибилла Мериан, Чарльз Дарвин и Альфред Вегенер. Наблюдая за растениями, Линней разработал нашу нынешнюю систему классификации родов и видов. Мария Сибилла Мериан, естествоиспытатель и научный иллюстратор, проложила путь современной ботанике своей публикацией 1675 года. Дарвин теоретизировал эволюцию, а Вегенер — континентальный дрейф после наблюдений за растениями, окаменелостями и другими живыми существами.и проложили путь к современным исследованиям растений. Вместе это одни из самых глубоких открытий в исторической науке, и все они явились результатом внимательного наблюдения за живым миром.

Жизненный цикл завода

Цветковые растения обычно проходят жизненный цикл. Растение вырастает из семени, которое содержит генетическую информацию и питательные вещества, необходимые растению для превращения в рассаду или детское растение. Затем растения получают энергию от солнца, которая используется в химических процессах для производства сахаров для их роста.

Когда растение подходит к концу своей жизни или подходит к концу вегетационного периода, оно дает много цветов. Затем, полагаясь на ветровые потоки или опылителей животных, пыльца с мужской части цветка, тычинок, переносится на женскую часть цветка, рыльце. Когда пыльца достигает яиц, она оплодотворяет их. Яйца разовьются в семена, которые после размножения разовьются, и жизненный цикл растения продолжится.

Хвойные или шишковидные деревья, такие как западный красный кедр, и споровые растения, такие как папоротники или мхи, имеют разные жизненные циклы, но все же следуют одной и той же концепции встречи двух половых частей и формирования зародышей нового растения.

Что такое сорняки?

Не все растения люди считают красивыми или полезными. Например, сорняки — это растения, которые растут там, где мы не хотим, чтобы они росли, но не все сорняки вредны. Некоторые обычные сорняки более питательны, чем шпинат, а другие — лекарственные. Узнав больше о растениях вокруг нас, в том числе о сорняках, мы сможем завоевать уважение к большему количеству растений, которые мы видим.

Словарь

Полный цветок: Цветок, содержащий все четыре части цветка: чашелистики, лепестки, тычинки и пестики.Противоположность несовершенного цветка, содержащего только один пол репродуктивных частей.

Фрагментация: Метод бесполого размножения, демонстрируемый некоторыми растениями. Возможность выращивать отдельные новые растения из одного растения, разорванного на отдельные части.

Интродуцированные виды: Вид, который не возник в определенном регионе, но сейчас обитает в этом регионе. Обычно заносится в регион людьми или при изменении условий окружающей среды.

Инвазивные виды: Интродуцированный вид, угрожающий местным видам или всей экосистеме.

Местные виды: Вид, возникший в этом регионе.

Семяпочки: Неоплодотворенные яйца в центре цветка. После внесения удобрений они разовьются в семена.

Лепестки: Разноцветные части цветка, которые привлекают опылителя к остальной части цветка.

Пестики: Часть цветка, содержащая женские репродуктивные части (семяпочки).

Чашелистики: Внешний слой цветка.Иногда выглядит как другой набор лепестков, а иногда как зеленые лепестки.

Тычинки: Часть цветка, содержащая мужские репродуктивные части (пыльца).

Таксономия: Метод классификации или категоризации чего-либо.

Кольца дерева: отмечает год роста дерева. Измеряется расстоянием от одного темного кольца до другого в поперечном сечении дерева.

Сосудистый камбиум: одиночных кольцевых слоя клеток между древесиной и корой ствола.Здесь вырастает новый рост как коры, так и сердцевины древесины.

Сорняк: Растение, которое кто-то не хочет выращивать там, где оно растет. Не обязательно плохой завод, просто субъективно не хотелось.

Другие ресурсы

Совет по инвазивным видам Британской Колумбии | Ресурсы

Музей биоразнообразия Битти | Гербарий

Ботанический сад ВанДузен | Учить

UBC Farm | Программа чудес фермы

Ботанический сад UBC | Образование

Специализированные стержневые бактерии ассоциируются с растениями, адаптированными к неблагоприятной окружающей среде с высоким содержанием кальция

Abstract

Карстовый рельеф образован растворением растворимых горных пород, таких как известняк и доломит.В почвах такого рельефа чрезмерное содержание обменного кальция серьезно ограничивает рост растений. Исследования доказали, что ризосферные микроорганизмы и эндофиты помогают растениям-хозяевам адаптироваться к различным неблагоприятным условиям окружающей среды. Адаптивная способность растений, которые растут в неблагоприятных условиях солевой среды, засухи, термических стрессов и тяжелых металлов, частично или полностью обеспечивается симбиотическими микроорганизмами. С помощью высокопроизводительного секвенирования ампликонов были проанализированы структуры бактериального сообщества в почве с высоким содержанием кальция, а также в корнях и листьях Cochlearia henryi , которые обычно встречаются в карстовых областях.Структуры сообщества бактерий в этих трех компартментах показали очевидные различия. Это означает, что C . henryi , который адаптируется к высокому кальциевому стрессу, избирательно сосуществует со специфическими бактериями. Хотя структуры сообщества бактерий в этих трех компартментах значительно различались, было 73 операционных таксономических единицы (OTU), общих для карстовых почв, а также для корней и листьев C . генри . Филогенетическое разнообразие этих 73 OTU значительно отличалось от такового для всех обнаруженных OTU.Также были очевидные различия в путях KEGG (Киотская энциклопедия генов и геномов) и значениях численности между 73 OTU и общими бактериальными сообществами. Большое количество ОТЕ разделяют карстовые почвы, корни и листья C . henryi имел тесную генетическую связь с известными стрессоустойчивыми штаммами бактерий. Наши результаты показали, что функциональные бактерии можно предсказать, исследуя основные бактерии, бактерии, общие для почвы, адаптируемые корни и листья растений.Эта информация потенциально ускорит исследования естественных микробных сообществ, которые могут способствовать адаптации растений-хозяев к высокому кальциевому стрессу, и будет полезна для поиска штаммов микробов для полевого применения в карстовой топографии.

Образец цитирования: Li F, Zhang X, Gong J, Liu L, Yi Y (2018) Специализированные стержневые бактерии ассоциируются с растениями, адаптированными к неблагоприятным условиям окружающей среды с высоким содержанием кальция. PLoS ONE 13 (3): e0194080. https: // doi.org / 10.1371 / journal.pone.0194080

Редактор: Рикардо Арока, Estacion Experimental del Zaidin, ИСПАНИЯ

Поступила: 1 августа 2017 г .; Принята к печати: 23 февраля 2018 г .; Опубликован: 8 марта 2018 г.

Авторские права: © 2018 Li et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные доступны в документе, его файлах с вспомогательной информацией и в GenBank (https://www.ncbi.nlm.nih.gov/popset) под номерами доступа MF114128-MF114200.

Финансирование: Работа была поддержана Фондом естественных наук провинции Гуйчжоу; Номер премии: [2016] 7212 | http://kjt.gzst.gov.cn/, Фонд Педагогического университета Гуйчжоу для ученых-докторов наук http://www.gznu.edu.cn/. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Введение

Ризосферные микроорганизмы и эндофиты могут помочь растениям-хозяевам адаптироваться к различным неблагоприятным условиям окружающей среды [1]. Свойства почвы — важнейший фактор, определяющий структуру сообществ ризосферных и эндофитных микроорганизмов растений [2,3]. Изучение и скрининг региональных адаптивных микроорганизмов является важным способом разработки микробных удобрений для обеспечения устойчивого развития регионального сельского хозяйства.

Карстовый регион с центром в провинции Гуйчжоу на юго-западе Китая является крупнейшим карстовым топографическим регионом в мире, охватывающим более 550 000 км. 2 . Почвы в карстовых регионах обладают двумя очевидными характеристиками. Во-первых, это высокое содержание обменных ионов кальция, достигающее 1% ~ 3%, что в несколько раз выше, чем в почвах в некарстовых регионах. Другой фактор — это крайне плохая почва и водосберегающая способность, из-за которой поверхность почвы подвергается сильной засухе [4].

Потребление кальция растениями напрямую связано с содержанием обменного кальция в почве. Высокое содержание кальция может привести к чрезмерному потреблению ионов кальция, вызывая серьезные повреждения, включая укрепление клеточных стенок, торможение роста клеток и нарушение энергетического обмена. Более того, чрезмерное потребление кальция вызывает повреждение мембраны растительной клетки, что снижает скорость фотосинтеза и транспирации, что приводит к старению листьев [5, 6]. Следовательно, растения, растущие в карстовой среде, должны обладать уникальными механизмами физиологической адаптации.

Недавние экспериментальные данные подтвердили, что адаптивная способность растений к неблагоприятной среде с солевым, сквозняком, термическим стрессом или стрессами тяжелых металлов частично или полностью приписывается симбиотическим микроорганизмам [7–12]. Тепличные и полевые эксперименты показали, что некоторые устойчивые к стрессу растения не могут адаптироваться к своей первоначальной среде обитания, если ключевые эндофиты удалены [7]. В настоящее время во всех проанализированных растениях обнаружены различные эндофитные микроорганизмы, такие как бактерии, грибы, микоризные грибы, вирусы и микроводоросли [9, 10, 13].Эти микроорганизмы существуют между клетками, в сосудах ксилемы и даже в клетках всех органов растений, включая корни, стебли, листья, цветы, плоды и семена [14, 15]. Эндофитные штаммы, выделенные из геотермальной среды обитания в Йеллоустонском национальном парке (США), засоленной среде обитания на морском побережье и сельскохозяйственных угодьях, могут инфицировать двудольные томаты и однодольные риса, и эти инокулированные растения обладают устойчивостью к жаре, соли и болезням, соответственно [ 8]. Обработка засухи Brassica rapa в течение трех последовательных поколений показывает, что засухоустойчивость B . рапа потомство существенно не меняется. Однако почвы, обработанные стрессом засухи, могут помочь растениям, растущим в них, адаптироваться к засухе, что указывает на то, что микроорганизмы в почвах эволюционируют быстрее, чтобы адаптироваться к неблагоприятным условиям, чем растения [16]. Некоторые ученые предполагают, что фенотип растений в природе является продуктом синергетического взаимодействия генома растения и микроорганизмов, широко существующих в ризосфере или эндосфере растений [15]. Cochlearia henryi , вид-родственник Arabidopsis thaliana , обычно встречается в карстовом регионе Хуацзян провинции Гуйчжоу (Китай). Микроорганизмы в карстовых почвах сталкиваются с кальциевым стрессом и эндофитами в корнях и листьях C . henryi должны адаптироваться к своему хозяину. Однако данные о физиологических и экологических эффектах C . henryi ризосферные микроорганизмы и эндофиты в карстовых регионах, уникальная экологическая система с высоким содержанием кальция, неизвестны, если не ограничены и требуют тщательного изучения.

В настоящем исследовании с целью выявления видов бактерий, широко присутствующих в карстовой экосистеме, связанных с C . henryi , три отсека, а именно карстовые почвы, корни и листья C . henryi были собраны для высокопроизводительного секвенирования ампликонов. «Основные» операционные таксономические единицы (ОТЕ), общие для карстовых почв, а также корней и листьев C . Было идентифицировано генри . Мы ожидали, что эти OTU должны адаптироваться к кальциевому стрессу и участвовать в адаптации C . henryi в карстовую экосистему. Чтобы проверить эту гипотезу, мы сравнили филогенетическое разнообразие и функциональное профилирование «основных» OTU и полных OTU и наблюдали значительные различия.

Материалы и методы

Выборка поля

С . henryi широко распространен в юго-западных карстовых регионах Китая. В июле 2016 года номер C . henryi Было собрано саженцев (средней высотой 20 см), произрастающих на карстовых почвах в отдаленных горах уезда Хуацзян, провинция Гуйчжоу, Китай (N25 ° 43’21 ”, E 105 ° 37’24”).Для полевого отбора проб не требовалось никаких специальных разрешений, и это полевое исследование не касалось исчезающих или охраняемых видов. Во избежание возможных отклонений при отборе проб, вызванных неоднородностью почвы, были выбраны два пробных участка на расстоянии примерно 3-5 м. Три C . henryi сеянцев (средняя высота около 20 см) с каждого участка собирали случайным образом в качестве биологических копий с каждого участка. Образцы были разделены на три части, включая почвы C . henryi корней и листьев. Все образцы были помещены в контейнеры для хранения при температуре 10 ° C, а затем быстро переданы в лабораторию для дальнейшей обработки.

Анализ почвы

Для анализа использовались образцы почв контрольных питательных почв и карстовых насыпных почв с пробного участка 1 и пробного участка 2. Образцы питательной почвы, использованные в качестве контроля для сравнения, предназначались для использования в теплицах и были куплены у Hunan Xiang Hui Agricultural Technology Development Co., ООО Для сбора грунта использовали шнековый буровой станок для отбора проб грунта под землей на глубину 20 см. Почвы измельчали ​​до частиц с помощью ступки, а затем сушили в течение 3 ч при 120 ° C для определения состава почвы. После высыхания образцы почвы фильтровали через сито 2 мм и использовали для анализа химических и физических свойств. PH образцов почвы определяли с помощью pH-метра с использованием почвенных растворов (соотношение почва: вода 1: 5), полученных встряхиванием суспензий при 20 ° C в течение 2 ч на шейкере.Обменный кальций (Ca), сульфат (S), калий (K) и магний (Mg) экстрагировали 1 н. Ch4COONh5 при щелочном pH = 9 и детектировали с использованием метода атомно-абсорбционной спектроскопии. Общий почвенный азот определялся по упрощенной версии метода Кьельдаля [17]. Азотные фракции (Nh5 и NO3) экстрагировали 1 М KCl и анализировали методом впрыска потока. Общий углерод в образцах почвы определяли методом влажного сжигания [18]. Фосфор (P) экстрагировали в 0,5 моль / л бикарбоната натрия при pH 8.5 и определяется путем выполнения анализа нагнетания потока. Раствор DTPA, содержащий 0,01 M CaCl2, 0,1 M TEA и 0,005 M DTPA, pH = 7,3) был использован для извлечения доступных форм алюминия (Al), меди (Cu), железа (Fe), натрия (Na), марганец (Mn) и цинк (Zn) перед определением их концентраций с помощью атомно-абсорбционной спектроскопии.

Эксперименты проводили в трех повторностях.

Способ уничтожения эпифитных микроорганизмов на тканях растений

Растительные ткани (корни и листья) замачивали в этаноле (75% об. / Об.) На 40 секунд, а затем в 1% (об. / Об.) Гипохлорите натрия на 4 минуты и, наконец, промывали стерильной дистиллированной водой 3 раза.Для проверки эффективности стерилизации стерильную воду, использованную для промывания, помещали в чашки и культивировали на среде LB. Исследование продолжалось только тогда, когда на среде LB не появлялись бактериальные колонии, что указывает на успешную стерилизацию поверхности. Затем стерилизованные ткани растений погружали в коммерческий раствор DNA AWAY на 5 минут, а затем промывали 3 раза стерильной водой.

Извлечение ДНК

ДНК

экстрагировали из корней и листьев C . henryi с помощью мини-набора DNeasy Plant (QIAGEN). ДНК выделяли из образцов почвы с помощью набора для выделения ДНК Power Soil (MOBIO). Пробы измельчали ​​в жидком азоте с использованием заранее замороженных стерильных ступок и пестиков. Около 100 мг образцов растений использовали для экстракции ДНК.

ПЦР-амплификация и пиросеквенирование

Четырнадцать подбиблиотек ампликонов были созданы для 454-пиросеквенирования, а именно две карстовые валовые почвы, три C . henryi корней и листьев на каждой из двух пробных площадок. OTU, которые неоднократно появлялись в этих четырнадцати библиотеках ампликонов, рассматривались как «основные OTU».

Праймеры для амплификации вариабельной области бактериальной 16S рРНК представляли собой праймер 515F-806R (515F: GTG CCA GCM GCC GCGGTAA и 806R: GGA CTA CHV GGG TWT CTA AT, вариабельная область V4). Доказано, что эта пара праймеров полезна для снижения загрязнения, вызванного амплификацией последовательностей растений. Затем платформа 454 GS FLX + (Roche) в Пекинском институте геномики (Шэньчжэнь, Китай) была использована для очистки геля и секвенирования ампликонов.Срезы ампликона восстанавливали, и липкие концы восстанавливали до плоских концов с помощью ДНК-полимеразы Т4, ДНК-полимеразы Кленова и полинуклеотидкиназы Т4. Затем нуклеотид «А» был добавлен к 3′-концу, чтобы ампликоны можно было соединить с адаптерами с нуклеотидом «Т» на 3’-конце. Прямые праймеры включали адаптер A праймера слияния 454 (CCATCTCATCCCTGCGTGTCTCCGAC), ключевую последовательность библиотеки размером 4 п.н. (TCAG), мультиплексный идентификатор длиной 10 п.о. (MID) (AGCGTCGTCT) и последовательности праймеров. Обратные праймеры состояли из адаптера B (CCTATCCCCTGTGTGCCTTGGCAGTC) и специфических последовательностей праймеров.

Контроль качества секвенирования и анализ данных

В процессах секвенирования и анализа данных использовались несколько методов контроля качества. Качество секвенирования проверяли с помощью программы Mothur (v1.31.2) [19]. Была использована команда trim.seqs, и конкретные операции описаны ниже. Последовательности были обрезаны, когда средняя оценка качества для окна 30bp упала ниже 20. Последовательности с конечной длиной менее 75% от исходной длины были обрезаны одинаково.Последовательности с неопределенным нуклеотидом, более 8 непрерывных одинаковых нуклеотидов или совместное загрязнение были удалены. Используя программное обеспечение Mothur unique.seqs. команды были получены неизбыточные последовательности. Программное обеспечение UCHIME версии 4.2 (http://drive5.com/uchime) использовалось для идентификации и удаления химер. Программное обеспечение FLASH (Быстрая корректировка длины коротких чтений, v1.2.11) использовалось для сопоставления последовательностей. На основе перекрывающихся последовательностей пары считываний, полученных в результате секвенирования парных концов, были собраны в тег.Теги, показывающие сходство 97% или больше, были сгруппированы в OTU с помощью программного обеспечения USEARCH (v7.0.1090). Последовательности OTU сравнивали с базой данных для аннотации видов с использованием программного обеспечения классификатора RDP v2.2 [20], и доверительный порог был установлен равным 0,8. Все OTU, которые были аннотированы как последовательности растительной плазмиды или митохондрии 16S рРНК, были удалены. Базы данных были Greengene (V201305) и RDP (Release9 201203). Классифицированные последовательности по таксонам и по образцам, сгенерированные с помощью обеих баз данных, подсчитывались по каждому рангу и нормализовались с количеством классифицированных последовательностей в данном ранге.

Статистический анализ

Чтобы оценить степень, в которой наш охват секвенированием отражает разнообразие последовательностей в каждом образце, мы провели анализ разрежения. Теги были случайным образом повторно дискретизированы на различной глубине, чтобы имитировать эффекты более низкого покрытия секвенированием. Для каждой смоделированной глубины секвенирования мы произвольно отобрали выборку с заменой и подсчитали количество OTU, идентифицированных в выбранном подмножестве. Отбор проб выполнялся 500 раз для каждой смоделированной глубины секвенирования для расчета среднего количества OTU, обнаруженных на каждой глубине.Анализ разрежения проводился с помощью программы mothur (версия 1.31.2) (S1 Рис).

Неметрическое многомерное масштабирование (NMDS) было проанализировано с использованием веганского пакета в R (v3.3.2). Диаграмма Венна, показывающая общие или определенные OTU каждого образца или компартмента, была создана с использованием пакета Venn Diagram в R (v3.3.2), Основные OTU, общие для почвы с высоким содержанием кальция, корней и листьев C . henryi были экранированы в соответствии с результатами диаграммы Венна.Филогенетические отношения ОТЕ, полученные путем сравнения с базами данных, были использованы для построения гистограммы численности видов бактериального сообщества. Для ОТЕ, обычно существующих в почве с высоким содержанием кальция, корни и листья C . henryi , анализ тепловой карты проводился в соответствии с относительной численностью каждой OTU в каждом образце.

Онлайн-инструмент «Филогенетическое исследование сообществ путем реконструкции ненаблюдаемых состояний» (PICRUSt) (http: // huttenhower.sph.harvard.edu/galaxy/root?tool_id=PICRUSt_normalize) использовался для анализа PICRUSt, следуя пошаговым инструкциям программного обеспечения. Во-первых, мы создали таблицу OTU, совместимую с PICRUSt, которая была нормализована по предсказанному числу 16S рДНК. Затем были получены прогнозы метагенома.

Результаты

Карстовые насыпные почвы в уезде Хуацзян щелочные и бесплодные с высоким содержанием кальция

Для определения характеристик почв в уезде Хуацзян были определены данные о составе образцов почвы из контрольных питательных почв (для использования в теплицах) и карстовых насыпных почв с пробного участка 1 и пробного участка 2.Как показано в таблице S1, карстовые насыпные почвы были щелочными (значение pH 7,68 и 8,02 для образцов почвы с пробного участка 1 и пробного участка 2, соответственно), а содержание обменного кальция было почти в 10 раз больше, чем в питательных почвах (2,28% для карстовая насыпная почва с пробного участка 1 и 1,98% для карстовой насыпной почвы с пробного участка 2 по сравнению с 0,24%). Однако органических питательных веществ, таких как углерод и азот, которые являются важными компонентами для роста растений, было меньше, чем в питательных почвах, что свидетельствует о значительной степени бесплодия.Эти результаты показали, что карстовые насыпные почвы в округе Хуацзян являются щелочными и бесплодными с высоким содержанием кальция, что указывает на функциональную роль определяющих факторов, таких как сообщество симбиотических бактерий, в росте растений на этих почвах.

Характеристика бактериального сообщества карстовой насыпной почвы и

C . генри корни и листья

Бактериальный ампликон 16S секвенировали на образцах почвы, а также на корнях и листьях C . henryi из двух пробных площадей. Анализ разреженности показал, что наш охват секвенированием эффективно улавливал разнообразие последовательностей в каждом образце (S1 фиг.). Обилие OTU в карстовых почвах с высоким содержанием кальция было значительно больше, чем в C . henryi корней и листьев. Аналогично количество ОТЕ в корнях и листьях C . henryi показал очевидные отличия. В C было меньше OTU. henryi листьев в сравнении с образцами корней (таблица 1).

Путем проведения анализа NMDS была четко отображена взаимосвязь между 5 образцами. На графике NMDS самые близкие образцы имели минимальную разницу в структуре бактериального сообщества. Два выходных образца C . генри были близко друг к другу, но далеко от корней и почвы. Два корневых образца C . генри также были близки друг к другу, что указывает на то, что C . henryi оказался селективным по отношению к эндофитам. С . henryi выбрал одни бактерии для проживания в его корнях, а другие — в его листьях. Другими словами, C . henryi и эндофиты тесно взаимодействуют друг с другом (рис. 1).

Рис. 1. Отделения для образцов управляют бактериальным составом.

На рисунке показан анализ неметрической многомерной шкалы (NMDS), основанный на филогенетической взаимосвязи, числовой матрице и матрице расстояний. Горизонтальная и вертикальная оси представляют расстояние, а каждая точка указывает образец.

https://doi.org/10.1371/journal.pone.0194080.g001

Селективное обогащение специфических бактерий в корнях и листьях

C . генри

Используя язык R для построения диаграммы Венна, общие и определенные OTU каждой выборки могут быть четко отображены (рис. 2). Бактериальные сообщества в том же компартменте (корни и листья) C . henryi между двумя участками для отбора проб в высококальциевой карстовой среде показали определенные различия.Физические и химические свойства почв на этих двух пробных площадях совпадали (таблица S1). Из-за близкого расстояния (5 метров), климата и окружающей среды C . henryi рост на этих двух участках также был практически одинаковым. Следовательно, наблюдаемые различия, вероятно, были вызваны разным генетическим фоном и, в меньшей степени, стадиями развития C . генри саженцев. Различия в структурах бактериальных сообществ на обоих участках были меньше, чем между разными компартментами (основная масса, корни и листья C ). генри саженцев). С помощью анализа диаграммы Венна 73 OTU (номера доступа в GenBank от MF114128 до MF114200) совместно используются карстовыми насыпными почвами, а также корнями и листьями C . Было идентифицировано henryi из двух пробных площадей (рис. 2). Бактерии, представленные этими 73 OTU, возможно, играют ключевую роль в адаптивной способности C . генри на карстовых высококальциевых почвах.

Хотя эти 73 OTU присутствовали во всех пяти образцах, их численность значительно различалась (рис. 3).Различия между участками отбора проб (два участка) незначительно повлияли на численность OTU, в то время как численность основных OTU показала большие различия между разными компартментами. Количество OTU, таких как OTU1, OTU2, OTU57 и OTU1147, в листьях C . henryi было намного выше, чем C . генри корни и карстовые насыпные почвы. Аналогично C . Корни henryi показали более высокое содержание OTU1050, OTU201 и OTU132, чем в листьях и почве.Физические функции OTU, показывающие разную численность в разных компартментах, являются важной проблемой, заслуживающей изучения.

Рис. 3. Обилие основных ОТЕ в карстовых почвах, а также в корнях и листьях C. henryi .

На рисунках 1 и 2 представлены два примерных графика. R и L обозначают корни и листья C. henryi . B представляет собой насыпной карстовый грунт. Различные участки отбора проб (пробные участки 1 и 2) незначительно влияли на численность OTU, в то время как наблюдалась значительная разница в содержании основных OTU в разных компартментах (корни (R), листья (L) и карстовый массив почвы (B)).

https://doi.org/10.1371/journal.pone.0194080.g003

Core OTU показали филогенетическое разнообразие, отличное от филогенетического разнообразия OTU в целом

Филогенетическое разнообразие основных OTU (рис. 4A) сильно отличалось от такового всех OTU (рис. 4B). Бактерия OP3 составляла важную часть C . henryi корни и листья эндофитов, но редко встречались в основных ОТЕ. Напротив, протеобактерии составляли подавляющее большинство основных OTU.Филогенетическое разнообразие и структура основных ОТЕ в C . henryi корни и листья также показали значительные различия. В C . henryi , протеобактерии были наиболее многочисленными, за ними следовали актинобактерии и бактероиды. Причем в C . henryi листьев, в OTU полностью доминировали протеобактерии (рис. 4A).

Рис. 4. Филогенетическое разнообразие и структура основных OTU (A) и общих OTU (B) в карстовых почвах, а также корни и листья C.Генри .

1 и 2 представляют собой два пробных участка. R и L обозначают корни и листья C. henryi соответственно. B обозначает карстовые насыпные почвы.

https://doi.org/10.1371/journal.pone.0194080.g004

Многоядерные OTU показали высокое сходство с известными стрессоустойчивыми бактериальными штаммами

Бласт-анализ (Nucleotide Blast в NCBI) основных OTU показал, что последовательности 16S рДНК по крайней мере 5 ядерных OTU показали очень высокое сходство с таковыми из известных устойчивых к кальциевому стрессу бактерий.Результаты (рис. 5) показали, что они попали в ацидобактерии, актинобактерии, цианобактерии, протеобактерии, Bacteroidetes, chloroflexi, gemmatimonadetes и verrucomicrobia. Альфа-протеобактерии были наиболее многочисленными во всех образцах (рис. 5). Обилие альфа-протеобактерий в листьях было выше, чем в корнях, что также было выше по сравнению с образцами почвы. Кроме того, гамма-протеобактерии были в изобилии в образцах почвы и корней, но редко в образцах листьев. Другие стрессоустойчивые OTU были более многочисленны в C . henryi корни и карстовые почвы с высоким содержанием кальция. К ним относятся Sphingobacteres (Bacteroidetes) и Verrucomicrobiales (Verrucomicrobiae).

Рис. 5. Таксономическое разнообразие и структура основных OTU в карстовых почвах, а также корни и листья C. henryi , устойчивые к кальциевому стрессу.

1 и 2 представляют собой два пробных участка. R и L обозначают корни и листья C. henryi соответственно. B обозначает карстовые насыпные почвы.

https: // doi.org / 10.1371 / journal.pone.0194080.g005

Функциональные профили основных OTU и общих OTU различались

Программное обеспечение PICRUSt, которое может прогнозировать функции бактерий без использования метагеномного секвенирования, использовалось для функциональной аннотации основных OTU и полных OTU. Большинство идентифицированных функциональных спектров присутствовали как у общих, так и у основных бактерий. Прогнозируемые функции включали переносчики ABC, восстановление несоответствия, метаболизм глутатиона, шапероны и катализаторы сворачивания, связанные с реакциями на стресс, а также энергетический метаболизм, метаболизм жирных кислот, гликолиз / глюконеогенез, метаболизм гликозилтрансфераз, глиоксилат и дикарбоксилат, относящиеся к основным метаболизмам.На рис. 6 показано относительное количество функций ортологов KEGG уровня 1 (KOs) в целом и в ядре бактерий в пяти образцах. Функциональный состав генов продемонстрировал значительные различия в карстовых почвах с высоким содержанием кальция, а также в корнях и листьях C . генри . Различие в компартментах было решающим фактором, влияющим на функциональный профиль генов бактериальных сообществ, что указывало на то, что различия функций генов бактериального сообщества были связаны с различными средами обитания, а именно с почвами с высоким содержанием кальция, корнями или листьями C . генри . В сообществе основных бактерий пропорции категорий генов были сопоставимы с теми, которые наблюдались в сообществе бактерий в целом. Это наблюдение подтвердило, что функциональные роли могут определяться коровыми бактериями, хотя взаимодействием между этими коровыми бактериями и другими OTU нельзя пренебрегать.

Обсуждение

Исследования показали, что существуют различные и многочисленные микробные сообщества в Arabidopsis thaliana [2, 3], сельскохозяйственных культурах (пшеница, кукуруза и рис) [21, 22] и хозяйственных культурах (хлопок и тополь), а также в их ризосфере [23, 24].Эти микробные сообщества могут значительно улучшить адаптационную способность растений-хозяев к неблагоприятным условиям окружающей среды. Высокое содержание кальция в карстовых почвах является важным ограничивающим фактором роста растительности в карстовой экологической системе. В этой работе путем секвенирования бактериальных 16S рДНК [25, 26] обсуждались состав и характеристики основных бактериальных сообществ, относящихся к адаптивным растениям в среде с высоким содержанием кальция.

В данном исследовании бактериальные сообщества структурируются в карстовых почвах с высоким содержанием кальция, а также в корнях и листьях C . henryi были проанализированы количественно. Кроме того, был проведен анализ NMDS для получения взаимосвязи между микробными сообществами в трех разных компартментах. Структура бактериального сообщества листьев С . henryi на двух пробных площадках показывает большое расстояние от корней и карстовых почв. Напротив, бактериальные сообщества в почвах с высоким содержанием кальция и корнях собрались вместе, что указывает на существование специфических бактерий, адаптирующихся к стрессу с высоким содержанием кальция [27].В листьях влияние растений-хозяев является основными детерминантными факторами, влияющими на структуры бактериального сообщества, в то время как селективное биологическое давление (эффекты хозяина) и небиологические факторы (стресс с высоким содержанием кальция) совместно определяют структуры бактериального сообщества в C . генри корней.

Текущие и предыдущие исследования показывают, что существуют сотни разнообразных микроорганизмов в ризосфере и эндофере корней растений. Предыдущие полевые исследования показали, что применение отдельных штаммов бактерий, как правило, не может привести к ожидаемым эффектам.Такая низкая эффективность внешних инокулированных штаммов в основном вызвана конкуренцией исходного микробного сообщества в почвах и растениях. Как найти бактериальные штаммы, которые могут стабильно заражать растения-хозяева и существенно влиять на них? Чтобы достичь этого, несколько исследователей предложили новую стратегию, то есть инокуляцию основных микробных сообществ вместо отдельных штаммов [28, 29].

Определение основных микробных сообществ может помочь исследователям исключить временные и нестабильные взаимодействия растений и микроорганизмов и сосредоточить ценные исследовательские ресурсы на бактериальных штаммах, которые постоянно и тесно сосуществуют с растениями и влияют на фенотипы хозяев.Используя анализ диаграммы Венна, 73 бактериальных OTU присутствуют в почвах с высоким содержанием кальция, а также в корнях и листьях C . генри . Кроме того, были проанализированы филогенетические и функциональные характеристики этих 73 основных ОТЕ. Филогенетические структуры основных OTU и общих OTU значительно различались. Согласно определению стержневых бактерий (бактериальные штаммы, общие для высококальциевых почв, а также корней и листьев C . henryi) , бактериальные штаммы, представленные основными 73 OTU, вероятно, были ключевыми бактериями, придающими C . henryi — его способность адаптироваться к высокому кальциевому карсту. Эти штаммы бактерий в основном принадлежали к типу Proteobacteria. Кроме того, с помощью высокоточного инструмента PICRUSt были предсказаны функции общих и основных бактериальных сообществ. В сообществе основных бактерий доля категорий генов, связанных с толерантностью к осмотическому и солевому стрессу, включая молекулярные шапероны, ген сворачивания белков, метаболизм β-аланина и биосинтез лизина, была больше, чем в сообществе бактерий в целом.Эти результаты выявили молекулярные механизмы, лежащие в основе механизма адаптации микробных сообществ к среде с высоким содержанием кальция, и помогли нам выяснить некоторые функциональные характеристики микробных сообществ, связанные с адаптационной способностью растения-хозяина. Существовали критические различия между функциональными спектрами общих и основных бактериальных сообществ. Функциональные спектры бактериальных сообществ между разными компартментами показали большие различия. Это также предполагает, что растение-хозяин как среда обитания бактерий значительно влияет на бактериальное сообщество.Стоит отметить, что результаты PICRUSt предлагают просто предполагаемую подтверждающую информацию, а не прямые доказательства, потому что анализ PICRUSt не может предоставить фактическое количество экспрессии генов [30]. Однако анализ с использованием одних и тех же процедур и стандартов может предоставить убедительные доказательства различий функциональных спектров бактерий между различными компартментами, а также между общими и коровыми бактериями в среде обитания с высоким содержанием кальция и карста.

Ключевым ограничением настоящего исследования было то, что работа была сосредоточена на описании бактериальных штаммов в карстовой почве, а также в корнях и листьях C . henry , который позволил идентифицировать основные OTU и последующее прогнозирующее функциональное профилирование с помощью PICRUST, но не исследовал экспериментально фактическую взаимосвязь основных бактерий с C . генри и как эти бактерии влияют на метаболические пути хозяина. Таким образом, дальнейшие хорошо спланированные и целенаправленные исследования C . Инфекция henry основными бактериями и их влияние на хозяина находятся в центре наших будущих исследовательских целей.

В заключение, это исследование позволяет по-новому взглянуть на структуру и функции почвенных микробных сообществ и эндофитов растений в неблагоприятной среде с высоким содержанием кальция. Результаты показали, что C . henryi растения, обычно встречающиеся в неблагоприятной среде с высоким содержанием кальция, адаптируются к стрессу с высоким содержанием кальция, тесно взаимодействуя с эндофитными микроорганизмами. В частности, потенциальные полезные функциональные бактерии были определены путем прогнозирования основных бактерий. Наши результаты ценны в том смысле, что они помогли нам найти микробные сообщества для полевых применений в карстовых экологических системах, и это ускорит экспериментальные исследования, направленные на определение микробных сообществ, которые могут способствовать адаптивной способности растений к среде с высоким содержанием кальция.Нет сомнений в том, что интеграция методов сверху вниз (обследование микробных сообществ на основе пиросеквенирования) и снизу вверх (эксперименты по бактериальной инокуляции) позволит лучше выявить функциональные характеристики микробных сообществ, выявленных в этом исследовании. Настоящее исследование показало значительные перспективы для устойчивого ведения сельского хозяйства в карстовых регионах по всему миру.

Вспомогательная информация

S1 Таблица. Карстовые почвы в уезде Хуацзян щелочные и бесплодные с высоким содержанием кальция.

Питательные почвы, использованные в качестве контроля для сравнения, предназначались для использования в теплицах. Эксперименты были выполнены в трех экземплярах, и данные представлены как среднее ± стандартное отклонение (стандартное отклонение).

https://doi.org/10.1371/journal.pone.0194080.s002

(DOCX)

Благодарности

Благодарим корпорацию BGI за техническую поддержку.

Ссылки

  1. 1. Ногалес А., Нобре Т., Валадас В., Рагонези С., Доринг М., Полидорос А. и др.Может ли функциональная гологеномика помочь в решении текущих проблем селекции растений? Брифинги по функциональной геномике. 2016; 15 (4): 288–97. Epub 2015/08/22. pmid: 26293603.
  2. 2. Bulgarelli D, Rott M, Schlaeppi K, Ver Loren van Themaat E, Ahmadinejad N, Assenza F и др. Выявление структуры и сборочных сигналов для бактериальной микробиоты, населяющей корни Arabidopsis. Природа. 2012. 488 (7409): 91–5. Epub 2012/08/04. pmid: 22859207.
  3. 3. Lundberg DS, Lebeis SL, Paredes SH, Yourstone S, Gehring J, Malfatti S и др.Определение основного микробиома корней Arabidopsis thaliana. Природа. 2012. 488 (7409): 86–90. Epub 2012/08/04. pmid: 22859206.
  4. 4. Нарисовал DP. Ускоренная эрозия почвы в карстовой области: Буррен, западная Ирландия. Журнал гидрологии. 1983; 61 (1): 113–24. https://doi.org/10.1016/0022-1694(83)-X.
  5. 5. Белый Пи Джей, Бродли MR. Кальций в растениях. Летопись ботаники. 2003. 92 (4): 487–511. pmid: 12933363
  6. 6. Martins TV, Эванс MJ, Woolfenden HC, Morris RJ.К физике кальциевых сигналов в растениях. Растения (Базель, Швейцария). 2013. 2 (4): 541–88. Epub 2013/01/01. pmid: 27137393.
  7. 7. Редман Р.С., Шихан КБ, Стаут Р.Г., Родригес Р.Дж., Хенсон Дж. М.. Термостойкость, вызванная симбиозом растений и грибов. Наука (Нью-Йорк, Нью-Йорк). 2002; 298 (5598): 1581. Epub 2002/11/26. pmid: 12446900.
  8. 8. Родригес Р.Дж., Хенсон Дж., Ван Волкенбург Э., Хой М., Райт Л., Беквит Ф. и др. Стрессоустойчивость растений через симбиоз, адаптированный к среде обитания.Журнал ISME. 2008. 2 (4): 404–16. Epub 2008/02/08. pmid: 18256707.
  9. 9. Гилберт С.Ф., Сапп Дж., Таубер А.И.. Симбиотический взгляд на жизнь: мы никогда не были личностями. Ежеквартальный обзор биологии. 2012. 87 (4): 325–41. Epub 2013/02/13. pmid: 23397797.
  10. 10. Берг Г., Грубе М., Шлотер М., Смолла К. Раскрытие микробиома растений: оглядываясь назад и перспективы на будущее. Границы микробиологии. 2014; 5: 148. Epub 2014/06/14. pmid: 24926286.
  11. 11.Santoyo G, Moreno-Hagelsieb G, Orozco-Mosqueda Mdel C, Glick BR. Бактериальные эндофиты, способствующие росту растений. Микробиологические исследования. 2016; 183: 92–9. Epub 2016/01/26. pmid: 26805622.
  12. 12. Юань З., Дружинина И.С., Лаббе Дж., Редман Р., Цинь Й., Родригес Р. и др. Специализированный микробиом галофита и его роль в обеспечении устойчивости растений, не являющихся хозяевами, к засолению. Научные отчеты. 2016; 6: 32467. Epub 2016/08/31. pmid: 27572178.
  13. 13. Рейнхольд-Гурек Б., Гурек Т.Внутри растений обитают: бактериальные эндофиты. Современное мнение в биологии растений. 2011. 14 (4): 435–43. Epub 2011/05/04. pmid: 21536480.
  14. 14. Thomas P, Sekhar AC. Визуализация живых клеток показывает обширную внутриклеточную цитоплазматическую колонизацию банана обычно некультивируемыми эндофитными бактериями. ЗАВОДЫ AoB. 2014; 6 (0). Epub 2014/05/03. pmid: 247.
  15. 15. Vandenkoornhuyse P, Quaiser A, Duhamel M, Le Van A, Dufresne A. Важность микробиома холобионта растения.Новый фитолог. 2015; 206 (4): 1196–206. Epub 2015/02/07. pmid: 25655016.
  16. 16. Лау Дж. А., Леннон Дж. Т.. Быстрая реакция почвенных микроорганизмов улучшает приспособленность растений к новым условиям окружающей среды. Труды Национальной академии наук Соединенных Штатов Америки. 2012. 109 (35): 14058–62. Epub 2012/08/15. pmid: 22891306.
  17. 17. Понтес Ф.В., Карнейро М.К., Вайтсман Д.С., да Роча Г.П., да Силва Л.И., Нето А.А. и др. Упрощенная версия метода общего азота Кьельдаля с использованием ультразвуковой системы очистки и улавливания аммиака и ионной хроматографии для анализа геологических проб.Analytica chimica acta. 2009. 632 (2): 284–8. Epub 2008/12/27. pmid: 19110106.
  18. 18. Ван Д., Чакраборти С., Вайндорф, округ Колумбия, Ли Б., Шарма А., Пол С. и др. Синтезированное использование VisNIR DRS и PXRF для характеристики почвы: общий углерод и общий азот. Геодермия. 2015; 243–244: 157–67. https://doi.org/10.1016/j.geoderma.2014.12.011.
  19. 19. Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, et al. Представляем mothur: программное обеспечение с открытым исходным кодом, независимое от платформы, поддерживаемое сообществом для описания и сравнения сообществ микробов.Прикладная и экологическая микробиология. 2009. 75 (23): 7537–41. Epub 2009/10/06. pmid: 19801464.
  20. 20. Ван Кью, Гроссмейстер Гаррити, Тидже Дж. М., Коул Дж. Р. Наивный байесовский классификатор для быстрого отнесения последовательностей рРНК к новой бактериальной таксономии. Прикладная и экологическая микробиология. 2007. 73 (16): 5261–7. Epub 26.06.2007. pmid: 17586664.
  21. 21. Пайффер Дж. А., Спор А., Корен О, Джин З., Триндж С. Г., Дангл Дж. Л. и др. Разнообразие и наследуемость микробиома ризосферы кукурузы в полевых условиях.Труды Национальной академии наук Соединенных Штатов Америки. 2013. 110 (16): 6548–53. Epub 2013/04/12. pmid: 23576752.
  22. 22. Эдвардс Дж., Джонсон С., Сантос-Медельин С., Лурье Э., Подишетти Н.К., Бхатнагар С. и др. Структура, вариация и сборка корневых микробиомов риса. Труды Национальной академии наук Соединенных Штатов Америки. 2015; 112 (8): E911–20. Epub 2015/01/22. pmid: 25605935.
  23. 23. Готтель Н.Р., Кастро Х.Ф., Керли М., Ян З., Пеллетье Д.А., Подар М. и др.Отчетливые микробные сообщества в эндосфере и ризосфере корней Populus deltoides на разных типах почв. Прикладная и экологическая микробиология. 2011; 77 (17): 5934–44. Epub 19.07.2011. pmid: 21764952.
  24. 24. Hacquard S, Schadt CW. На пути к целостному пониманию полезных взаимодействий микробиома Populus. Новый фитолог. 2015; 205 (4): 1424–30. Epub 2014/11/26. pmid: 25422041.
  25. 25. Гутман Д.С., Макхарди А.С., Шульце-Леферт П.Анализ взаимодействия растений и микроорганизмов на основе микробного генома. Природа рассматривает генетику. 2014. 15 (12): 797–813. Epub 2014/10/01. pmid: 25266034.
  26. 26. van der Heijden MG, Schlaeppi K. Поверхность корней как рубеж для исследования микробиома растений. Труды Национальной академии наук Соединенных Штатов Америки. 2015; 112 (8): 2299–300. Epub 2015/02/26. pmid: 25713090.
  27. 27. Хорнер-Девайн МС, Боханнан Б.Дж. Филогенетическая кластеризация и чрезмерная дисперсия в бактериальных сообществах.Экология. 2006; 87 (7 доп.): S100–8. Epub 2006/08/23. pmid: 16922306.
  28. 28. Лакшманан В., Селварадж Г., Байс ХП. Функциональный микробиом почвы: подземные решения надземной проблемы. Физиология растений. 2014. 166 (2): 689–700. Epub 2014/07/26. pmid: 25059708.
  29. 29. Lebeis SL. Потенциал компромиссов в отношениях между растением и микробиомом. Границы растениеводства. 2014; 5: 287. Epub 2014/07/08. pmid: 24999348.
  30. 30. Cleary DF, de Voogd NJ, Polonia AR, Freitas R, Gomes NC.Состав и предиктивный функциональный анализ бактериальных сообществ в морской воде, отложениях и губках на архипелаге Спермонда, Индонезия. Микробная экология. 2015; 70 (4): 889–903. Epub 2015/06/15. pmid: 26072397.

Ботаника Глава 22: Семенные растения; Голосеменные

Семенные растения хорошо приспособлены к жизни на суше:
а) иметь пыльцу , переносимую ветром или животными вместо спермы.
б) не имеют отдельного растения-гаметофита, вместо этого женский гаметофит защищен внутри семени.
в) семена намного крупнее спор, с большими запасами пищи, поэтому они могут жить много дольше до прорастания.

Все гетероспористые (пыльца и яйцеклетка). Впервые они появились около 400 миллионов лет назад.

Голосеменные
Голосеменные имеют голых, семян (не окруженных завязью). У них нет цветков, зато семена производятся в шишках . Это самые ранние возникшие семенные растения.Голосеменные растения (например, сосны) обычно опыляются ветром . Современные голосеменные делятся на четыре типа:

1) Тип Gnetophyta Близкие родственники цветковых растений (покрытосеменные). Сегодня сохранились два основных рода: Ephedra и Welwitschia .

Эфедра — пустынное растение (запад США) с крошечными листьями. Он производит нектар, привлекающий насекомых для опыления.Общее название: «Мормонский чай», он используется в лечебных целях коренными американцами.
Эфедра содержит эфедрин, применяется для лечения астмы, сенной лихорадки. Пищевые добавки, содержащие эфедру, были запрещены в 2004 году после того, как они стали причиной более 100 смертей.

Псевдоэфедрин используется в некоторых лекарствах от простуды (также используется при производстве метамфетамина).

Вельвичия — пустынное растение (Африка) с двумя листьями и длинным стержневым корнем. Он получает большую часть воды из тумана и росы, которые конденсируются на листьях ночью.Фотографии. Окаменелости Welwitschia почти 300 миллионов лет.

2) Phylum Cycadophyta (саговники) В основном тропический / субтропический. Часто сажают в декоративных целях (общее название «саговые пальмы» нет, они не имеют отношения к пальмам, которые являются цветущими растениями! ). Опыление ветром: пыльцевая трубка приближается к яйцеклетке, а затем выделяет сперму.

Примеры: род Cycas (пальма саго) Пальма саговая. Обычно выращивается во Флориде, родом из Азии.
Замия (Кунти, или Эррорут). Это родом из Флориды. Племя тимукуан из Северной Флориды измельчило корни этого растения, чтобы испечь хлеб.

3) Тип Ginkgophyta Выживает только 1 вид: Ginkgo biloba . Родом из Китая, он почти не изменился почти 300 миллионов лет. Он двудомный, имеет треугольные листья, листопадные. Сперма выделяется из конца пыльцевой трубки (как у саговников).
Гинкго устойчив к загрязнению воздуха, поэтому его высаживают во многих городах. Семена очень плохо пахнут (как гниющее мясо), поэтому обычно сажают только мужские деревья.

Гинкго считается полезным при лечении болезни Альцгеймера, хотя необходимы дополнительные исследования.

4) Phylum Coniferophyta (хвойные) До сих пор существует более 700 видов. Хвойные деревья часто являются доминирующими деревьями в холодном климате, например, в Канаде. Стебель усилен лигнином , поэтому они могут вырасти очень высокими.

Обычно вечнозеленые, Засухоустойчивые : Листья игольчатые, кутикула толстая, устьица погружены в ямки.
Стебель становится шире (вторичный рост) за счет камбия , который дает ксилема на внутренней стороне стебля и флоэма снаружи.

опыление ветром; пыльцевая трубка прорастает до яйца. Обычно бисексуалов (или однодомных): каждое дерево дает маленькие мужские шишки и большие долгоживущие женские шишки.

Хвойные деревья важны для производства древесины, бумаги и т. Д. Сосна косая. Во Флориде почти половина штата покрыта лесами, а на северо-востоке Флориды производство бумаги и пиломатериалов превышает 7 миллиардов долларов в год.
Пример: род Pinus .

Дендрохронология Дендрохронология включает датирование прошлых событий путем изучения роста годичных колец. Деревья обычно быстро растут весной, а осенью рост прекращается. производящие годовые кольца в ксилеме.Образец («сердцевина») древесины удаляется с помощью сверлильного станка . Дендрохронология

Часто используются хвойные породы, например Pinus longaeva (Шишковидная сосна). Самому старому живому конусу из щетины было 5000 лет. Текущие записи (с использованием деревьев, погибших много веков назад) в Европе и США насчитывают более 9000 лет.

Дендрохронология используется в:
а) датировка археологических памятников.
б) изучение прошлых климатических изменений. Исследование 2011 года с использованием дендрохронологии показало, что империя ацтеков в Мексике рухнула из-за многолетней засухи.
в) с указанием прошлых повреждений, нанесенных огнем и насекомыми.

Как растения переносят засушливые дни? · Границы для молодых умов

Аннотация

Растения постоянно находятся в засушливых условиях. Недостаток воды представляет серьезную угрозу для способности растения расти и развиваться или даже просто выживать! Если растения погибнут, нам не хватит еды! Как растениям удается выжить в условиях нехватки воды? Они должны каким-то образом уметь ощущать изменения в доступности воды, реагировать на них и адаптироваться к ним.Они делают это с помощью ряда методов, которые позволяют растениям бороться с нехваткой воды. Структурная «броня» растения помогает ему уменьшить количество воды, которую оно теряет в окружающую среду, и увеличить запас воды. Растения очень комплексно реагируют на нехватку воды. Эти реакции могут включать изменения в росте растений и их способности защищаться от токсичных химикатов, которые накапливаются в растении в засушливые периоды. Все реакции растения напрямую контролируются генами растения.Если мы сможем понять гены, которые участвуют в защите растений от засухи, в будущем мы сможем производить генетически модифицированные культуры, которые смогут выдерживать глобальное потепление и изменения климата.

Вы слышали, как люди говорят о глобальном потеплении и изменении климата? Вы знаете, что означают эти термины? Эти термины в основном подразумевают, что Земля с каждым годом становится все горячее. Эти более высокие температуры приводят к неожиданным и необычным погодным условиям. Одним из таких экстремальных погодных явлений являются частые и сильные засухи.Засуха — это очень продолжительные засушливые периоды без дождя. Что означают сильные засухи для растений? Что ж, растения сидячие , что означает, что они остаются на одном месте и не могут двигаться, как мы. Они не могут вырвать корни и перебраться в тенистое или сырое место. Следовательно, растениям нужно как-то справляться с этими постоянно усиливающимися засушливыми условиями, иначе они просто умрут. Помните, что растения — это наша пища. Мы едим растения в сыром или вареном виде (те овощи, которые ваша мама настаивает на том, чтобы вы их ели!) Или обработанные, как ваша любимая коробка хлопьев для завтрака [которые сделаны из пшеницы или кукурузы (кукурузы)].Итак, если растения погибнут из-за засухи, нам не хватит еды!

Если вокруг нет воды, что растения могут сделать, чтобы выжить? Удивительно, но у всех растений, похоже, есть несколько генов для стратегий защиты от засухи, закодированных в их ДНК. Гены — это небольшие участки ДНК, похожие на главы в книге. То, как они используют эти гены, определяет их способность пережить засуху.

Некоторые растения засухоустойчивы. Когда мы говорим о засухоустойчивых растениях, мы имеем в виду растения, которые могут выдерживать засуху и не погибать.Засухоустойчивое растение может пережить засуху, используя три стратегии защиты: ускользать, избегать потери воды или терпеть ее [1]. Засухоустойчивые растения довольно редки в природе и могут выдерживать длительные периоды без воды. Некоторые из наиболее впечатляющих засухоустойчивых растений называются воскрешающими. Воскресенцы способны долгое время (до 3 лет!) Жить без воды. Однако дайте им немного воды, и они вернутся к жизни через день или два. Другие засухоустойчивые растения могут быть не такими впечатляющими, но они тоже могут пережить короткие периоды засухи, используя специальные методы и стратегии защиты.

У некоторых растений есть особые структуры, которые помогают им выжить в условиях засухи

Некоторые растения способны пережить засуху благодаря своей уникальной структуре. Эти структурные особенности включают в себя внешнюю броню растений, которая защищает их от потери воды, а также инструменты, помогающие растениям поглощать и накапливать воду. Засухоустойчивые растения можно специально приспособить для жизни и выживания в очень засушливых условиях. Эти растения часто выглядят совершенно иначе, чем растения, обитающие в районах, где легко доступна вода.У засухоустойчивых растений обычно есть особые особенности «избегания» (одна из защитных приспособлений!), Чтобы гарантировать, что меньше воды теряется в окружающей среде или больше воды поглощается и хранится в растении. Растения, называемые пустынными суккулентами , являются хорошим примером растений, у которых есть стратегии предотвращения засухи [2]. У пустынных суккулентов толстые мясистые листья, которые часто совсем не похожи на листья, и толстый восковой слой, предотвращающий потерю воды. У пустынных суккулентов также есть обширная корневая система, которая ищет воду под сухой почвой пустыни (рис. 1).У некоторых суккулентов есть специализированные корни, которые образуют большие луковичные структуры, которые на самом деле являются подземными резервуарами для воды для растения. Эти растения могут пережить годы засухи, используя воду, хранящуюся в их луковицах.

  • Рис. 1. Чрезвычайные структурные изменения, обнаруженные в растениях для борьбы с потерей воды и хранения большего количества воды.

Большая часть воды, которую теряет растение, теряется из-за естественного процесса, называемого транспирация . У растений есть маленькие поры (отверстия) на нижней стороне листьев, которые называются устьицами .Растения впитывают воду своими корнями и выпускают воду в виде пара в воздух через устьица. Чтобы выжить в условиях засухи, растениям необходимо уменьшить транспирацию, чтобы ограничить потерю воды. Некоторые растения, живущие в засушливых условиях, в результате эволюции имеют более мелкие листья и, следовательно, меньшее количество устьиц. Крайний пример — растения с листьями, напоминающими колючие шипы. Некоторые растения также могут полностью сбрасывать листья во время засухи, чтобы предотвратить потерю воды. Основное правило — меньшее количество листьев означает меньшую потерю воды из-за транспирации.Такая экстремальная адаптация листьев также может защитить растения от голодных и жаждущих птиц и животных (рис. 1). Вы, конечно, не хотели бы закусывать!

Некоторые приспособления довольно умны и включают в себя растения, «спасающиеся» от засухи в качестве семян (помните, побег — это еще одна стратегия защиты). Семена выживают во время засухи и очень быстро прорастают (прорастают), вырастают и дают больше семян, когда идут дожди. Затем эти семена разбрасываются, и они также могут длительное время выдерживать экстремальные суровые условия.Присмотревшись к пустынным почвам, вы найдете множество семян, которые просто ждут дождя, прежде чем снова прорастут.

У некоторых растений также есть внутренняя защита от засухи

Помимо специальных конструкций, у растений есть внутренняя защита от нехватки воды. Когда растение испытывает засушливые условия, внутри растения быстро происходят некоторые реакции, которые помогают ему справиться со стрессом, вызванным засухой. Эти реакции, которые происходят в растении, часто бывают довольно сложными и изощренными.Приведем несколько примеров.

Растения все еще нуждаются в фотосинтезе во время засухи

Растения зеленые, потому что содержат зеленое химическое вещество, называемое хлорофиллом. Хлорофилл упакован в специальные структуры, называемые хлоропластами, которые являются энергетическими фабриками растений. Вместе с водой и углекислым газом (CO 2 ) хлорофилл использует солнечный свет для создания сахаров. Эти сахара позволяют растению расти и процветать. Это процесс фотосинтеза , и он связан с наличием воды.

Когда в почве растения мало воды, процесс фотосинтеза будет происходить немного иначе и приведет к накоплению вредных химических веществ, называемых свободными радикалами . Это означает, что растениям необходимо тщательно контролировать то, как они используют энергию солнца. Во время фотосинтеза CO 2 должен поступать в растение через устьица (упомянутые ранее маленькие поры). Но помните, что открытые устьицы означают, что вода будет потеряна из-за испарения! Таким образом, растение сталкивается с трудной проблемой — обеспечить достаточное количество воды и CO 2 для фотосинтеза.Для этого растения используют «менеджер», называемый абсцизовой кислотой ( ABA ).

Когда растение испытывает нехватку воды, АБК быстро продуцируется и транспортируется к устьицам. В устьицах ABA контролирует, как устьица открываются и закрываются, манипулируя так называемым тургорным давлением (Рисунок 2) [3]. Тургорное давление — это давление, оказываемое на стенку растительной клетки жидкостями внутри клетки. Чем больше воды в ячейке (чем больше ячейка), тем больше давление.Управление тургорным давлением обеспечивает баланс между потреблением CO 2 и потерей воды, так что может происходить фотосинтез. Но если вода останется ограниченной в условиях засухи, в конечном итоге растение не сможет справиться со стрессом засухи, и весь фотосинтетический процесс может перестать работать должным образом. Однако засухоустойчивые растения придумали хитрый способ избежать проблемы потери воды во время фотосинтеза. Они открывают устьица только в ночную прохладу, чтобы поглотить CO 2 .Затем они хранят этот CO 2 и используют его в дневное время для фотосинтеза. Таким образом, они теряют меньше воды в течение дня, потому что устьицы могут оставаться закрытыми, но они могут продолжать расти, хотя и немного медленнее, чем обычно.

  • Рисунок 2 — Внутренняя защита растений при водном стрессе.
  • (А) . Когда в почве достаточно воды, растения впитывают воду своими корнями. Эта вода будет использоваться растением или выделяться через транспирацию через открытые устьицы на листьях.Фотосинтез также будет происходить нормально, когда CO 2 и кислород поглощаются и высвобождаются через открытые устьица. (В) . Но когда количество воды в почве ограничено, растения стараются предотвратить ее потерю. Потери воды из-за транспирации можно уменьшить, закрыв устьица на листьях с помощью вещества, называемого ABA. Когда устьица закрыты, фотосинтез снижается, потому что CO 2 не может проникнуть через закрытые устьицы. Меньше фотосинтеза означает, что растение производит меньше энергии и перестает расти.

Растения нуждаются в защите от опасных свободных радикалов

В условиях засухи, когда кажется, что растение не может должным образом сбалансировать фотосинтез и потерю воды, ему придется иметь дело с неприятными маленькими молекулами, называемыми свободными радикалами. Свободные радикалы возникают естественным образом во время фотосинтеза, но когда воды мало, образуется больше свободных радикалов. Свободные радикалы могут быть очень опасными для клетки, потому что они могут вызвать повреждение ДНК, клеточных мембран, белков и сахаров (все эти вещества необходимы для выживания клетки)!

Растения привыкли иметь дело с низким количеством свободных радикалов.Однако засухоустойчивые растения действительно хорошо справляются со свободными радикалами, потому что они накапливают защитные вещества. Эти защитные вещества называются поглотителями свободных радикалов. Присутствие поглотителей свободных радикалов часто вызывает изменение цвета растения. Когда эти мусорщики накапливаются, растения часто становятся красными или пурпурными (вы видите лиловые листья сухого растения на рис. 3В?). Поглотители свободных радикалов широко распространены в природе и очень хорошо уничтожают свободные радикалы, защищая растения от их вредного воздействия.

  • Рисунок 3 — Воскресительное растение, Craterostigma pumilum .
  • (А) . Так выглядит растение, когда оно растет в условиях, когда достаточно воды. (В) . На двух средних картинках показано растение, когда нет воды, после 3 недель без воды. Тебе это не кажется мертвым? (К) . Если полить такое же сухое, мертвое растение, в течение 2 недель оно оправится от засухи и начнет давать семена.

Растениям необходимо контролировать количество воды в клетках

Осмос — важное понятие в биологии. По сути, осмос — это движение воды через мембрану (например, клеточную мембрану) в область, где определенные молекулы (например, соли, сахара и свободные радикалы) встречаются в более высоких концентрациях. Таким образом, вода снизит концентрацию этих молекул, так что концентрация будет одинаковой с обеих сторон мембраны. А теперь подумайте, что происходит с растением, страдающим от потери воды.Для осмоса недостаточно воды, поэтому молекулы становятся сверхконцентрированными внутри растительных клеток. Обычно это нехорошо, особенно если эти молекулы являются свободными радикалами.

И снова у засухоустойчивых растений есть несколько очень крутых стратегий для борьбы с этой проблемой. При первых признаках засухи в клетках этих растений накапливается связка молекул, участвующих в так называемой осмотической регулировке (ОА) [3]. OA — изменение концентрации растворенного вещества на в ячейке.Это похоже на растворение сахара в воде, где сахар является растворенным веществом. Эти молекулы (растворенные вещества) могут быть сахарами, аминокислотами или небольшими белками. Эти молекулы предназначены для ограничения движения воды из клетки. Что делает эти молекулы OA уникальными по устойчивости к засухе, так это то, что они выполняют множество функций. Молекулы OA могут физически связываться с ДНК и белками, чтобы защитить их от свободных радикалов. Они также могут связывать саму воду, не давая ей выйти из клеток растения. Эти молекулы OA также связываются с мембранами, стабилизируя структуру растения, когда вода ограничена.

Воскрешающие растения — прекрасные примеры того, как засухоустойчивые растения объединяют концепции, которые мы обсуждали до сих пор. Воскресительные растения способны пережить полную потерю воды. Они накапливают огромное количество OA, высвобождают поглотители свободных радикалов и производят специальные защитные белки, чтобы пережить длительные и суровые засухи. Все это они делают, одновременно складывая листья и дожидаясь дождя (рис. 3). Процесс можно сравнить с уходом медведя в спячку.

Гены растения контролируют его реакцию на засуху

Имейте в виду, что мы очень упрощенно обсуждали эти процессы, используемые для защиты растений от засухи. Присмотреться к этим процессам на самом деле очень сложно. На самом базовом уровне эти процессы регулируются использованием растением своего генетического кода — своих генов. Вещества, необходимые для переживания засухи, будут произведены при доступе к этому коду в нужное время. Этот доступ к генетическому коду, чтобы помочь растению пережить засуху, называется генетическим ответом растения.

Генетические реакции растения, испытывающего стресс от засухи, очень сложны — многие гены включены или выключены. Используя передовые компьютерные технологии, ученые теперь могут идентифицировать большинство генов, которые играют роль в защите растений от засухи. Эта технология обнаружила, что буквально сотни генов включаются и выключаются в зависимости от того, где и когда они нужны! Мы не можем перечислить все эти гены, потому что вам будет совсем скучно в конце первой страницы! Мы, , скажем, , что эти гены в основном делятся на три группы: (1) гены, которые контролируют другие гены , важные для включения и выключения генов; (2) гены, вырабатывающие вещества, которые помогают защитить растения от засухи; и (3) гены, участвующие в поглощении и транспортировке воды.

Как вы думаете, почему важно знать, какие гены помогают растениям избегать засухи или переносить ее? Большинство наших культур фактически не способны пережить засуху. Как мы собираемся защитить наши посевы или сделать их более устойчивыми к засухе? Нам необходимо использовать знания о генах, которые включаются или выключаются в условиях засухи, чтобы производить растения, более устойчивые к засухе.

За прошедшие годы растениеводы добились определенных успехов в выращивании засухоустойчивых культур.Эти засухоустойчивые культуры были получены в основном путем отбора и селекции отдельных растений, которые хорошо выжили в условиях засухи. За последние несколько десятилетий ученые, работающие над генетически модифицированными (ГМ) растениями, также начали уделять внимание производству засухоустойчивых культур [4].

Для создания ГМ-растения новый ген (из любого источника!) Вставляется в ДНК растения. Встраивая этот новый ген / гены, ученый надеется привнести новый полезный признак в ГМ-растение. Представьте себе возможность выбрать из сотен полезных генов в воскрешающем растении и ввести некоторые из них в пшеницу! К сожалению, было успешно выращено лишь несколько ГМ засухоустойчивых растений (таких как кукуруза / кукуруза и сахарный тростник).Необходимо проделать гораздо больше работы, в том числе убедить широкую публику в том, что ГМ-растения не опасны!

Заключение

Растения действительно уязвимы, когда дело доходит до нехватки воды. Засуха повлияет на рост, развитие, продуктивность растений и, в конечном итоге, на их выживание. Однако у растений есть встроенная защита от засухи. У них могут быть некоторые структурные приспособления, позволяющие избегать обезвоживания или переносить его. У них также есть некоторая внутренняя защита, которая активируется, чтобы попытаться ограничить потерю воды, когда они понимают, что воды становится мало.Все эти защитные системы регулируются генами растений. Знание этих генов и того, как они участвуют в защите растений от засухи, дает человечеству надежду на создание устойчивых к засухе ГМ-культур.

Глоссарий

Sessile : Организм, который не может двигаться и остается на одном месте, как растение.

Суккуленты : Растения с утолщенными и мясистыми листьями и стеблями, в которых можно хранить воду.

Транспирация : Процесс, при котором корни растений впитывают воду, а затем выделяют водяной пар через поры (устьица) в листьях.

Устьица : Маленькие отверстия на нижней поверхности листа, через которые вода и газ могут проникать внутрь растения и выходить из него.

Фотосинтез : Процесс, при котором растения используют воду, свет и CO 2 для производства собственной пищи (в виде сахаров) и выделения кислорода в воздух.

Свободные радикалы : Молекулы, которые будут реагировать и повредить все, с чем они соприкасаются.

ABA : Растительный гормон, называемый абсцизовой кислотой, который помогает поддерживать водный баланс растений.

Тургорное давление : Напряжение, оказываемое на стенку растительной клетки жидкостями внутри клетки. Представьте, что вы наполняете воздушный шарик, который вы поместили в стеклянную банку. Чем больше вы наполняете баллон, тем больше он прижимается к жесткой стеклянной банке, как жидкость — к жесткой стенке растительной клетки.

Осмос : Перемещение воды через клеточную мембрану от одной клетки к следующей. Почему? Для обеспечения равных концентраций растворенных веществ на обеих сторонах мембраны.

Осмотическая регулировка : Изменение концентрации растворенных веществ в растительной клетке.

Раствор : Вещество (например, сахар), которое вы растворяете в растворе (например, в воде).

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.


Благодарности

Фигурки были созданы на платформе Mind the Graph (www.mindthegraph.com).


Список литературы

[1] Басу, С., Рамеговда, В., Кумар, А., Перейра, А. 2016. Адаптация растений к стрессу засухи. F1000Res 5 (F1000 Faculty Rev): 1554. DOI: 10.12688 / f1000research.7678.1

[2] Диммит, М. А. 1997. Как растения справляются с климатом пустыни. Sonorensis. Vol. 17. Доступно по адресу: http: // www.desertmuseum.org/programs/succulents_adaptation.php

[3] Осакабе Ю., Осакабе К., Шинозаки К. и Лам-Сон Т. 2014. Реакция растений на водный стресс. Фронт. Plant Sci. 5 (86): 1–8. DOI: 10.3389 / fpls.2014.00086

[4] Блюм, А. 2014. Геномика засухоустойчивости — спуск на землю. Функц. Plant Biol. 41: 1191–8. DOI: 10.1071 / FP14018

Обзор микробиома растений: экология, функции и новые тенденции в применении микробов

Стефан Компант работает ученым по взаимодействию растений и микробов в Австрийском технологическом институте AIT.Он получил докторскую степень в Университете Реймса-Шампань-Арденны и степень в области экологии в Университете Бордо во Франции. Стефан Компан был адъюнкт-профессором микробиологии в Национальном политехническом институте Тулузы во Франции, прежде чем он присоединился к AIT. Он является одним из ведущих специалистов по микробной экологии эндофитных бактерий, взаимодействующих с растениями, по микроскопии взаимодействия растений с микробами в целом и по биологическому контролю болезней растений.

Абдул Самад в настоящее время работает младшим научным сотрудником в Австрийском технологическом институте AIT.Он получил докторскую степень по микробиологии в Университете природных ресурсов и прикладных наук о жизни, Вена, Австрия. Его докторская степень была в основном сосредоточена на структурной и функциональной характеристике бактериальных сообществ, ассоциированных с растениями, и на биологическом контроле над сорняками. В настоящее время он работает над разработкой биоудобрений, уделяя особое внимание бактериям, солюбилизирующим фосфор и железо. Он имеет большой опыт в области взаимодействия растений и микробов, почвоведения, анализа микробных сообществ и анализа последовательностей NGS.

Ханна Фаист , младший научный сотрудник Австрийского технологического института AIT, является частью европейского проекта Horizon 2020 SolACE (Решения для улучшения агроэкосистемы и эффективности сельскохозяйственных культур с точки зрения использования воды и питательных веществ). Недавно Ханна Фейст раскрыла роль бактериального сообщества в культурах, подверженных комбинированным стрессам и различным методам управления. Ранее в Университете Вюрцбурга она исследовала желчную болезнь растений, занесенную патогенными агробактериями.Это включало характеристику гена и его влияние на липидом коронных галлов и бактериальное сообщество больных и здоровых виноградных лоз. Сочетая вычислительные и молекулярно-биологические навыки, ее исследования сосредоточены на взаимодействии бактерий и растений.

Анджела Сессич возглавляет отдел биоресурсов австрийского технологического института AIT. Она изучала биохимию в Технологическом университете в Граце, имеет докторскую степень по микробиологии Университета Вагенингена, Нидерланды, а также получила хабилитат в Венском университете природных ресурсов и наук о жизни.Она была пионером в создании микробиомов, связанных с растениями, особенно в эндосфере, и она заинтересована в понимании взаимодействия между растениями, микробиомами и окружающей средой, а также в разработке приложений. Ее группа исследует разнообразие и функционирование микробиоты растений, применяя ряд молекулярных подходов, режимы взаимодействия между растениями и модельными бактериями, колонизирующее поведение эндофитов, а также различные прикладные технологии для приложений биоконтроля и улучшения сельскохозяйственных культур.

© 2019 Авторы. Опубликовано Elsevier B.V. от имени Каирского университета.

Несосудистые растения: примеры, определение и характеристики — видео и стенограмма урока

Примеры несосудистых растений

Несосудистые растения также называют мохообразными и делятся на три различных типа, включая мхи, печеночники и роголистники. Мхи — это несосудистые растения, которые чаще всего встречаются покрывающими лесную подстилку или стволы деревьев.У большинства мхов короткий центральный стебель с жесткими ветвями и очень мелкие листообразные структуры. Эти мохообразные часто выглядят мягкими и мягкими, а также могут напоминать перья. Мхи — самые распространенные и разнообразные мохообразные, они могут выжить даже в пустынях. Некоторые мхи могут пережить полное обезвоживание, а затем регидратироваться, когда вода снова станет доступной.

Роголистник имеет тонкие ветвистые структуры и листья, похожие на мягкие сосновые иголки.Эти мохообразные предпочитают очень влажную среду, а некоторые даже встречаются в прудах и озерах. Затопленный роголистник может вырасти больше мха и печеночника, потому что вода обеспечивает им поддержку и структуру.

Печеночники часто называют простейшими растениями. Их обычно идентифицируют по сплющенным листьям, которые часто растут в два четких ряда. Печеночники из-за сплюснутых листьев растут очень низко к земле и образуют на поверхности большие маты.Их можно найти в наземной или полуводной среде, и их часто называют сорняками, потому что они могут легко захватить сельскохозяйственные угодья, если земля достаточно влажная.

Важность несосудистых растений

Хотя несосудистые растения часто упускаются из виду во время похода из-за их небольшого размера и местоположения, на самом деле они очень важны для окружающей среды, в которой они живут. Есть некоторые виды мхов, которые могут поглощать и удерживать до семи раз больше их веса в воде.Эта способность впитывать воду может быть очень полезной, поскольку помогает поддерживать влажную среду. Вода, хранящаяся в растении, медленно испаряется и позволяет окружающей среде оставаться влажной еще долгое время после дождя.

Несосудистые растения также могут быть полезны для окружающей среды, поскольку они обеспечивают почву. Некоторые несосудистые растения производят различные питательные вещества, которые попадают в почву и могут использоваться другими растениями. Кроме того, несосудистые растения, которые покрывают большую площадь, помогают поддерживать сплоченность земли, снижая риск эрозии.

Несосудистые растения также очень важны для животных. Известно, что насекомые используют в качестве укрытия несосудистые растения. Известно также, что многие виды птиц используют несосудистые растения, особенно мхи, в качестве строительного материала для своих гнезд.

Краткое содержание урока

Несосудистые растения , также известные как мохообразные, представляют собой небольшие простые растения без сосудистой системы.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

2019 © Все права защищены | Группа компаний«chudopal group» | Карта сайта